| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCUCACUCUUGCUGGAGGCGAGCCACUACCAUUCUGCUGAGAAGGAA… | 3665 nt | 0.3836 |
Enables L-glutamate uniporter activity. Involved in L-glutamate import and phosphate ion homeostasis. Located in synaptic vesicle membrane. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice demonstrated that chronic cocaine exposure and withdrawal induced profound transcriptomic changes in the nucleus accumbens, including a sustained down-regulation of the vesicular glutamate transporter VGLUT2, encoded by the SLC17A6 [Eipper-Mains et al. DOI:10.1111/J.1601-183X.2012.00873.X]. A separate review of alcohol toxicity literature noted that elevated miR-467b-5p in neonatal mouse hippocampus targets and down-regulates the SLC17A6 [Mandal et al. DOI:10.1002/JAT.3504].