| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUUGCAGCCUCCUUCCCCCCGAGCGGAGCUGCGGGGCCGGCCGGGCCG… | 2949 nt | 0.5771 |
The protein encoded by this gene is a vesicle-bound, sodium-dependent phosphate transporter that is specifically expressed in the neuron-rich regions of the brain. It is preferentially associated with the membranes of synaptic vesicles and functions in glutamate transport. The protein shares 82% identity with the differentiation-associated Na-dependent inorganic phosphate cotransporter and they appear to form a distinct class within the Na+/Pi cotransporter family. [provided by RefSeq, Jul 2008]
A study in human postmortem brain tissue identified the SLC17A7 as a protein-coding transcript and cortical marker enriched in the dorsolateral prefrontal cortex of unaffected comparison subjects [Seney et al. DOI:10.1016/j.biopsych.2021.06.007].