| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCUGAGAGUGGCUGCCUGAGACAGCUGCCACAGGCUGCUGCAGAGCG… | 3834 nt | 0.4082 | |
| AGUCUGAGAGUGGCUGCCUGAGACAGCUGCCACAGGCUGCUGCAGAGCG… | 3984 nt | 0.4066 |
This gene encodes a vesicular glutamate transporter. The encoded protein transports the neurotransmitter glutamate into synaptic vesicles before it is released into the synaptic cleft. Mutations in this gene are the cause of autosomal-dominant nonsyndromic type 25 deafness. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
A study in Wistar rats demonstrated that the SLC17A8 exhibited region-specific expression changes in the brain following alcohol exposure and withdrawal, with a significant decrease in the prefrontal cortex during the alcoholic condition but an increase during withdrawal, while its expression was significantly increased in the hippocampus under both conditions [Sinirlioglu et al. DOI: 10.14715/Cmb/2017.63.2.7]. A study in Wistar rats demonstrated that the SLC17A8 mRNA expression was significantly altered in specific brain regions following ethanol exposure and withdrawal, with expression decreasing in the prefrontal cortex during the alcoholic condition but increasing during withdrawal and increasing significantly in the hippocampus under both alcoholic and withdrawal conditions [Sinirlioglu et al. DOI:10.14715/Cmb/2017.63.2.7].