Basic Information

Symbol
SLC18A2
RNA class
mRNA
Alias
Solute Carrier Family 18 Member A2 SVMT VAT2 Synaptic Vesicular Amine Transporter VMAT2 SVAT Solute Carrier Family 18 (Vesicular Monoamine Transporter), Member 2 Vesicular Monoamine Transporter 2 Vesicular Amine Transporter 2 Synaptic Vesicle Monoamine Transporter, Brain Synaptic Vesicle Amine Transporter, Brain Monoamine Neurotransmitter Transporter Vesicle Monoamine Transporter Type 2 Solute Carrier Family 18 Member 2 Vesicle Monoamine/H+ Antiporter PKDYS2
Location (GRCh38)
Forensic tag(s)
Sudden unexpected death diagnosis

MANE select

Transcript ID
NM_003054.6
Sequence length
3831.0 nt
GC content
0.4195

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1117.60 kcal/mol
Thermodynamic ensemble
Free energy: -1192.53 kcal/mol
Frequency: 0.0000
Diversity: 861.97
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((.(((((((....(((.((((((((((((.((((.(((......))))))).)))))(((((...(((((.((((((((.((.(((((.((.(((((((.(((....(((((....(((((...(((((((((((.((((((((((..((.(((((((((((((((..(((....)))..)))).)))))).....((((.((((((.(((((((((((....((((((..((......(((...........))).......))..))))))..(((((.......))))).......))))).))).)))))))).).)))).............((((((.....(((.(((............)))..)))(((..(((((((((....((((......(..((((.......))))..).......))))..)))))))))....))).)))))).((((..((((...))))))))(((((((((..((..(((....)))...))..))))).))))..........))))).)).)))))...........(((.....)))....(((.....))).(((((....)))))((((........))))....(((.((((.((((....)))).))))..)))......((((((..........))))))...))))).))))).))))))...))))).....))))).(((((...((.((.((((....)))).)).))..)))))((((((.............)))))))))..))).)))).)).))))).))..((((((((....))))))))(((((((.((((((((((((......)))))).....((((((((((..((((((((.....))))))).)..)))))))))).....((((((((.(((.((.(((...))).)).)))))))))))....(((((...)))))...)))))).)))))))..((((.(((((.....((.((.(((((((..(((...)))..(((((......))))).))))))).))...))......)))))))))(((((((...((((..((((((((((((.((((((((((...(((((((.((((((((.......((((....))))......)))))))).)).(((((..(((((((..(((.(((((.(((..(((((((((((((((((.((((((((((...))))..((((.((((((((..((..((((....))))(((((((...))))))))).)))))))).))))(((((((...((((...)))).))))))).((((((((((((.(..(((.(((....(((((..((((..((....)).)))).)))))))).)))...).))))))))).)))..((((((...((((.....(((....)))..))))...))))))...))))))..))))))))))(((..((..((...))..))..)))......((((((((((((...((......))....)))))))))..))).))))))).))).)))))..)))................((((((...........((((((((((((..........((((.....))))((.(((..(((.((((((....................(((((.........)))))(((((......)))))..))))))))).))).))(((.((.(((((........)))))...)).)))((((...))))....((((((((...(((((.((((...((((((((((((((....((((((......)))))).)))))).(((((((((.((((((.(((((((((((.(((((((((...))))))))).(((((((((...((.....))...)))))))))..........(((((((.........)))))))...(((((..((.................))..)))))((.((..(((((((.((((((.......)))))).)))))))..)).))(((((......)))))....)))))))))))(((.....))).....(((((....(((.((((...(((((((.....))))))))))).)))..))))).))))))))))))))).....(((((....((((((.((.((((..((((((((((.((((((((((...((((......))))...)))))))))).))))))...))...))..)))))).))))))))))).....(((((....)))))......)))))))).....)))).)))))..))))))))((((.....))))..((((((((.....(((((.........))))).....))....)))))).....(((((((((((((((..((((((((((.........((((((....))))))....(((((..(((.....))).))))).(((.....))).....((((..(((((.......)))))..))))(((....)))((((.((((..........(.(((((.....(((((((....)))))))(((.((......)).))).........(((((((..((((((((........)))))))).)))))))(((.((((((....)))))))))..(((((..((....))..)))))....((((.((((((........)))))).)))).....))))).)))))))))..........(((.(((((.......).)))).)))......)))))))))).)))).).))))))))))(((.(((((((((..(((((((((....((((...((((((......)))))).)))))).)))))))...)))))...)))).)))))))))))))))))))))((((((((.....))).)))))...........(((.((((((.(((.((((((((..(((..((((((((....))))))))))).))))))))))).((((........))))...)))))).)))......)))))))...)))))(((((((((.....)))))))))....((((((...)))))).....((..((((((..((((......)))).))))))..))...((((.(((.((((........)))).))).))))....)))))..)))))))...))).)).)))))))))))))).)))).)))...(((((((((((....(((.....)))(((((......(((((((....))))))))))))......(((((.............)))))...))))))))))))))))))).))))))))))...............((((........))))......))))))).))))))))))..(((((...((((......))))...((((.((((....))))..))))..............)))))....(((((((.......)))))))..(((((......((((((((.((...((((......(((((((.....)))))))........))))...)).)))))))).....)))))((((((......(((((((.(((((((((..((.........))..)))))..))))..)))))))....))))))..(((((((((....(((....))).(((((.((((((......))))))..)))))..)))))))))......(((((.(((((((.....)))).))))))))))...
Thermodynamic Ensemble Prediction
((.,((((((....(((.((((((((((((.((((.(((......))))))).)))))(((((...(((((.((((((((.((.(((((.((.(((((((.((((.(((,.(({...(((((...(((((((((((.((((((((((..((.(((((((((((((((..(((....)))..)))).)))))).....((((.,(((((.(((((((((((....{{({{(..{{{{{..{(((,....,,,,,..,.,|,..{{||,.,|||||,.,{(,,..,...,))))),,,},..))))).)))},))))))).),))}},,..........,|{{{({.....{{|,||{.,,,........}}}..}}}{{{..(((((((((....((((....,.{..((((.......))))..).,.....))))..)))))))))..,.}}}.)}}}},.{,,,..{{{{...)))))}||((({(((((..((,.(((....)))...))..))))).))))}}........))))).)).)))))...........(((.....)))....,||.....,,|((((((....))))))|,(.....,,,||||....(((.((((.((((....)))).))))..)))....,,((((((..,.......))))))...))))).))))).))))))...))))).{,{{,|||.((((((...((.((.((((....)))).)).))..)))))).||,|.,}.,,,.}})..)))}.))))..)))},))).)).))))).))..((((((((....))))))))(((((((.((((((((((((,....,))))))..,,.((((((((((..((((((((.....)))))))},..))))))))))..||.((((((((.(((.((.(((...))).)).)))))))))))..,.(((((...)))))...)))))).)))))))..((((.(((((.....((.((.(((((((..{((...}}}..{((((,,...,)))}).))))))).))...))..,,..)))))))))(((((((.{.{(((..((((((((((((.((((((((((...(((((((.((((((((..,....((((....))))...,..)))))))).)).(((({,{((((({({.(({.(((((.(((..(((((((((((((((((,((((({{(({...}}}}{(((((.((((((({..,...,{{{....}}}|(((((({...})))))))},)))))))).)))))}{((((,.,{{{{..,}}|||||}}}||,{((((((((((({({.{(({{(,...}|{{||},||||}.||,,,,{|.||||.|||||}|}.}}}.,,},)))))})))}))}.,|||||{.,,|||{||,||{{(.,,,||,..})))},.)}}},,))})))))).,)))))))))}(((..((..({...})..))..)))......((((((((((((...{,......}}....)))))))))..))),))))))).))).))))),.}))},,,,..........{(((((({..........{(((((((((((.{{{.({{{.{(((.....)))}....(({(((({((((((...........,|,,....,|{{{{...,,....,}))}(((((......)))))..,}}}},,,}.,}}}))}}}}))}},{||,}.,,,..|||}|...|,.||,{(((...)))}....{(((((((...(((((.((((...((((((((((((((....((((((......)))))),)))}),,(((((((({,((((((.{((((((((((.(((((((((...})))))))}.(((((((((,,{({...,)))},.))))))))}..........{{{((((........,|||||}}...,,.{,,.......,,,......,}}))}.......{{,,,..(((((((.((((((.......)))))).)))))))..}}.,,(((((......)))))....))))))))))|(((.....))),....(((({.,,.(((.((((...(((((((.....))))))))))).))).,))))).)))))))))))))))}....(((((,...((((((.((.((((..((((((((((.((((((((((...((((......,)))...)))))))))).))))))...)),..})..)))))).))))))))))).....(((((....))))).,,...)))))))).....)))).)))))..)))))))}((((,,...||||..{,,,((...,...,||,....,,||||}}}}),,,........}))))).},..(((((((((((((((..((((((((((.......,{({((({.,{..|||||{,..((({(..({{.....})).}))))}|||.....}}).|,..||||.,{{{{(,{{..,,|||,,.{{|(((((....))))).|}|},.,}}}....}}|}|,,.......(((((((....))))))){((.((......)}.)))..,......(((((((..((((((((........)))))))).))))))){{{.{(((((....)))))}|)},,{((((,..,.....,..},..},,,,||.{||({{({,{{{{.{{{{|...........}})))))))))))))),..........{{{.{{{{|,.....,},})}}.}},.,....)))))))))).)))).),}))))))))}(((.(((((((((..(((((((({....{{((,{{{{{{{{.....,)))))).})}))),,})))))...))))),..}))).)))))))))))))))))))))|{{(((({.....}}},}}}}}..,|||,..,,(({.{((({{.,{,.((((((((..{{,..((((((({....})))))))})).)))))))),},.((((........))))...}}}}}},}||||||,,||}}}}}.,.}}||}(((((((((.....))))))))).,||{,,.,,....,((((((({.....}))))))){{,,...,,.))))}},.,,},}}|||.((((.(((.((((........)))).))).)))),,..)))))..)))))))...))).)).)))))))))))))).)))).)))...(((((((((({...,{((.....)}){{({{...,||{{{{(((....)))))))))}}}...,,.(((((.............))))).},))))))))))))))))))).))))))))))...............((((........))))......))))))).)))}||||}|,{{,{{((..((({......}))).}}|{{{.((((....))))..},},...............(((({{{,..,||||}}||,..,,,,,,}}}|{{(({{{{{{{{{,,,.||||,}}|{{{,.....(((((((.....})))))).,}))),.}}}},}}}}.}))))}}},..,.||,,.((((((..,...(((((((.{((((((((..((.........))..)))))}.}))}..)))))))....))))))..(((((((((....(({....,,|{(((((.{(({{{......})}))}.,))))}..)))))))))..,,..|||||,|||||,,,,,..,,,,.}))))),.))...

Transcripts

ID Sequence Length GC content
GGGGCGGAGACUGCGACCCGGAGCCGCCCGGACUGACGGAGCCCACUGC… 3831 nt 0.4195
Summary

This gene encodes an transmembrane protein that functions as an ATP-dependent transporter of monoamines, such as dopamine, norepinephrine, serotonin, and histamine. This protein transports amine neurotransmitters into synaptic vesicles. Polymorphisms in this gene may be associated with schizophrenia, bipolar disorder, and other neurological/psychiatric ailments. [provided by RefSeq, Jun 2018]

Forensic Context

A study in mice demonstrated that prenatal exposure to psychostimulants permanently impairs glucose homeostasis by reducing insulin and serotonin content in pancreatic beta cells, an effect linked to the serotonin transporter SLC6A4 and involving sex-specific epigenetic reprogramming of serotonin-related gene networks [Korchynska et al. DOI:10.15252/embj.2018100882]. In human infants, single-nucleus RNA sequencing of brainstem tissue from a sudden infant death syndrome (SIDS) case with occult human parechovirus 3 infection revealed reduced transcript abundance of the SLC18A2 in serotonergic neurons, alongside a broader host interferon response [Ramachandran et al. DOI:10.1001/jamaneurol.2023.5387].