| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGGGCGGAGACUGCGACCCGGAGCCGCCCGGACUGACGGAGCCCACUGC… | 3831 nt | 0.4195 |
This gene encodes an transmembrane protein that functions as an ATP-dependent transporter of monoamines, such as dopamine, norepinephrine, serotonin, and histamine. This protein transports amine neurotransmitters into synaptic vesicles. Polymorphisms in this gene may be associated with schizophrenia, bipolar disorder, and other neurological/psychiatric ailments. [provided by RefSeq, Jun 2018]
A study in mice demonstrated that prenatal exposure to psychostimulants permanently impairs glucose homeostasis by reducing insulin and serotonin content in pancreatic beta cells, an effect linked to the serotonin transporter SLC6A4 and involving sex-specific epigenetic reprogramming of serotonin-related gene networks [Korchynska et al. DOI:10.15252/embj.2018100882]. In human infants, single-nucleus RNA sequencing of brainstem tissue from a sudden infant death syndrome (SIDS) case with occult human parechovirus 3 infection revealed reduced transcript abundance of the SLC18A2 in serotonergic neurons, alongside a broader host interferon response [Ramachandran et al. DOI:10.1001/jamaneurol.2023.5387].