| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAGAGCCGACGCGAGGGGAGGGGAGCGCAGCGGCGGGGCUAACGGGCGG… | 2411 nt | 0.6715 |
This gene is a member of the vesicular amine transporter family. The encoded transmembrane protein transports acetylcholine into secretory vesicles for release into the extracellular space. Acetylcholine transport utilizes a proton gradient established by a vacuolar ATPase. This gene is located within the first intron of the choline acetyltransferase gene. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the mRNA of the SLC18A3 was significantly upregulated in salivary extracellular vesicles from concussion clinic patients compared to healthy controls (p=0.0153) and also showed a significant difference in expression between emergency department patients and concussion clinic patients (p=0.002) [Cheng et al. DOI:10.1002/jcp.28139].