| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAAAACUACCGGGCUGGCAGGGCGGCGGGCGCGGUGCGCGAUCCCGGG… | 3698 nt | 0.4394 |
This gene encodes a member of the high-affinity glutamate transporters that play an essential role in transporting glutamate across plasma membranes. In brain, these transporters are crucial in terminating the postsynaptic action of the neurotransmitter glutamate, and in maintaining extracellular glutamate concentrations below neurotoxic levels. This transporter also transports aspartate, and mutations in this gene are thought to cause dicarboxylicamino aciduria, also known as glutamate-aspartate transport defect. [provided by RefSeq, Mar 2010]
A study in rats demonstrated that the SLC1A1 was significantly downregulated in left ventricular tissues from an ischemic cardiomyopathy model created via coronary artery ligation [Wang et al. DOI:10.1007/s12031-018-1066-6].