| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGAGUGAUGGCUGCCGGCGCUCUCUGCGUGGUUCUUCUUCUCGGCCGCU… | 3297 nt | 0.4625 |
The protein encoded by this gene is a sodium-phosphate symporter that absorbs phosphate from interstitial fluid for use in cellular functions such as metabolism, signal transduction, and nucleic acid and lipid synthesis. The encoded protein is also a retroviral receptor, causing human cells to be susceptible to infection by gibbon ape leukemia virus, simian sarcoma-associated virus, feline leukemia virus subgroup B, and 10A1 murine leukemia virus.[provided by RefSeq, Mar 2011]
A study in rhesus macaques identified the SLC20A1 as a shared upregulated differentially expressed gene in left ventricular tissue between adult human and rhesus macaque hypertrophic cardiomyopathy [Rivas et al. DOI:10.1038/s41598-024-82770-4].