Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCCUUCGCCGGCGCCGCUCUGCCUGCCAGCGGGGCGCGCCUUGCGGCCC… | 3349 nt | 0.5148 | |
| GCCUUCGCCGGCGCCGCUCUGCCUGCCAGCGGGGCGCGCCUUGCGGCCC… | 3277 nt | 0.5145 |
Summary
Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. The encoded protein is a plasma integral membrane protein which functions both as an organic cation transporter and as a sodium-dependent high affinity carnitine transporter. The encoded protein is involved in the active cellular uptake of carnitine. Mutations in this gene are the cause of systemic primary carnitine deficiency (CDSP), an autosomal recessive disorder manifested early in life by hypoketotic hypoglycemia and acute metabolic decompensation, and later in life by skeletal myopathy or cardiomyopathy. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Forensic Context
A study in human left ventricle tissues prioritized 123 sudden unexplained death (SUD) susceptibility genes and characterized their post-mortem RNA degradation patterns, segmenting them into three tiers based on correlation with post-mortem interval [Shen et al. DOI:10.1007/s00414-025-03575-2]. The SLC22A5 was identified as a prioritized SUD susceptibility gene harboring four pathogenic or likely pathogenic variants, and its expression pattern was analyzed within the context of the overall degradation framework established for interpreting transcriptome profiling in forensic SUD investigations. A study in humans demonstrated that the rs397729601 deletion allele in the DSG2 3' UTR significantly increases sudden cardiac death (SCD) risk (OR=1.51) and correlates with higher myocardial DSG2 mRNA expression, as it functionally interrupts miR-933-3p binding [Zou et al. DOI:10.1016/J.Forsciint.2019.06.008]. Another human study found the rs3036297 insertion allele in the HSPA1B 3' UTR is associated with a lower SCD risk (OR=0.58), as it creates a binding site for miR-134-5p, while the deletion allele correlates with higher HLA-DRB5 expression via a long-range cis-regulatory interaction [Yang et al. DOI:10.1016/J.Forsciint.2020.110637]. These genetic polymorphisms represent potential biomarkers for SCD diagnosis and genetic counseling in forensic practice.