| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAUAGCGACGAGGAGGGCGACGACGAGGAGACGGGCAGCGGCGAGGAGG… | 3922 nt | 0.5352 |
Plasma membrane sodium/calcium exchangers are an important component of intracellular calcium homeostasis and electrical conduction. Potassium-dependent sodium/calcium exchangers such as SLC24A3 are believed to transport 1 intracellular calcium and 1 potassium ion in exchange for 4 extracellular sodium ions (Kraev et al., 2001 [PubMed 11294880]).[supplied by OMIM, Mar 2008]
A study in humans demonstrated that the SLC24A3 was downregulated in subcutaneous adipose tissue during short-term (0-5 month) weight loss in obese participants [Bollepalli et al. DOI:10.1038/ijo.2017.245].