| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGCCCCCUAGCGUCGCGCAGGGUCGGGGACUGCGCGGCGGUGCCAGGCC… | 4415 nt | 0.4643 |
This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein forms a homodimer embedded in the inner mitochondria membrane. Mutations in this gene have been shown to result in autosomal dominant progressive external opthalmoplegia and familial hypertrophic cardiomyopathy. [provided by RefSeq, Jun 2013]
A study in dogs demonstrated that a convolutional Siamese neural network could predict functional RNA expression profiles, including the SLC25A4, from wound images with a Mean Absolute Percent Error (MAPE) ranging from approximately 5% to 30% [Teague et al. DOI:10.1016/j.jss.2023.07.017]. In human myocardium, transcriptomic analysis of sudden cardiac death revealed the SLC25A4 was down-regulated in left ventricular samples from individuals with a high active fibrosis signature compared to other cases [Caudal et al. DOI:10.1016/j.jacep.2024.08.013].