Basic Information

Symbol
SLC25A4
RNA class
mRNA
Alias
Solute Carrier Family 25 Member 4 AAC1 ADP/ATP Translocase 1 ANT1 T1 Solute Carrier Family 25 (Mitochondrial Carrier; Adenine Nucleotide Translocator), Member 4 Progressive External Ophthalmoplegia 3 Progressive External Ophthalmoplegia 2 Adenine Nucleotide Translocator 1 ADP,ATP Carrier Protein 1 ADP/ATP Carrier 1 ANT 1 PEO2 PEO3 ADP,ATP Carrier Protein, Heart/Skeletal Muscle Isoform T1 Adenine Nucleotide Translocator 1 (Skeletal Muscle) ADP,ATP Carrier Protein, Heart/Skeletal Muscle Heart/Skeletal Muscle ATP/ADP Translocator MTDPS12A MTDPS12 PEOA2 ANT
Location (GRCh38)
Forensic tag(s)
Wound age identification Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_001151.4
Sequence length
4415.0 nt
GC content
0.4643

Transcripts

ID Sequence Length GC content
GGCCCCCUAGCGUCGCGCAGGGUCGGGGACUGCGCGGCGGUGCCAGGCC… 4415 nt 0.4643
Summary

This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein forms a homodimer embedded in the inner mitochondria membrane. Mutations in this gene have been shown to result in autosomal dominant progressive external opthalmoplegia and familial hypertrophic cardiomyopathy. [provided by RefSeq, Jun 2013]

Forensic Context

A study in dogs demonstrated that a convolutional Siamese neural network could predict functional RNA expression profiles, including the SLC25A4, from wound images with a Mean Absolute Percent Error (MAPE) ranging from approximately 5% to 30% [Teague et al. DOI:10.1016/j.jss.2023.07.017]. In human myocardium, transcriptomic analysis of sudden cardiac death revealed the SLC25A4 was down-regulated in left ventricular samples from individuals with a high active fibrosis signature compared to other cases [Caudal et al. DOI:10.1016/j.jacep.2024.08.013].