| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCUUUCGGUCCAGGCGGCGGCAGGGCUGAGCCAGCGACGCCCUCCAUUC… | 1451 nt | 0.6072 |
This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein is implicated in the function of the permability transition pore complex (PTPC), which regulates the release of mitochondrial products that induce apoptosis. The human genome contains several non-transcribed pseudogenes of this gene. [provided by RefSeq, Jun 2013]
A study in human blood plasma demonstrated that the SLC25A6 (antithrombin-III) was significantly downregulated with age and was used as part of a proteomic signature for chronological age prediction [Salignon et al. DOI:10.18632/aging.204787].