Basic Information

Symbol
SLC25A6
RNA class
mRNA
Alias
Solute Carrier Family 25 Member 6 ANT3Y ANT3 Solute Carrier Family 25 (Mitochondrial Carrier; Adenine Nucleotide Translocator), Member 6 Adenine Nucleotide Translocator 3 ADP,ATP Carrier Protein 3 ADP/ATP Translocase 3 MGC17525 ANT 2 ANT 3 AAC3 Epididymis Secretory Sperm Binding Protein ADP,ATP Carrier Protein, Isoform T2 ADP,ATP Carrier Protein, Liver ADP/ATP Translocator Of Liver ANT
Location (GRCh38)
Forensic tag(s)
Chronological age estimation

MANE select

Transcript ID
NM_001636.4
Sequence length
1451.0 nt
GC content
0.6072

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-563.90 kcal/mol
Thermodynamic ensemble
Free energy: -589.91 kcal/mol
Frequency: 0.0000
Diversity: 279.48
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((..((((....((.(((((.((((((((...(((....(((...(((..((((((((........)))((.(((((.(((((((((...((...))...)).).)))))).(((((......((......)).....))))))))))))..(((((.(((.(((...))).))).)))))...((((.(((((((((.((((((((((......))))).).))))(((((((((((.((((....(((((.((.(.....).)).))))).((((((((.(((((.(((((....((((((((((((..((((((((((....))))..........(((.............)))...........))))))))))).)))))..)).....))))).))))).)))))))).....((((.(.((((((((......((((...)))))))))))).).))))..))))))))......)))))))..)).))))))).))))..(((((.......))))).))))).))))))..))).)))..((((((((((((((.((((((.(((...((((((((((...))))))........))))))).))))))(((.(.((((((.((.(((((.((((.(((.....(((((((..((((.(((..(((.(((((((...)))).)))))))))..((((((((.((((.....(((.(((...)))))).((.(((((((((((((..((.(((((((((((((((.(((.(((((..........)))))...))).))))((((((((...((((((.........))).))).)))))))).)))))...)))))).((.((((((......)))))))).((((((((((...)))))))))).)).)))))))))....)))).))))))..))))))))((((((..(((.(((......))).)))....)))))).........(((((((..((((((.(((..............((((((..((((.(((((((..((....))...)))).(((...((.........))...))).))).))))))))))((((...(((.(((.......))).)))...))))........((..(((...)))..))....(((((...)))))((((((.......)))))))))))))))..)))))))..(((.....))))))).))))))).....))).)))).))))))).)))))).).))).....)))))....))))))))).(((((......(((((...........))))).......)))))))))).)).)))))((((((((((((..(((..((((((((......)).))))))..)))))).))))))))).........))))..)))))..
Thermodynamic Ensemble Prediction
(((((..((((.....((((((((((((...))))...((((..(((..,.....,.((((.((.(({{((((((.,(((((.(((((((((.({(((({,.,,.....))..))))}...,,(({{{(((((,{....}))))),)))))....(((((.(((.(((...))).))).)))))...{(((.((((((({,.((((((((((......))))).),}))){((((((((({{((((....(((({.({.{{....}.)}.})))).((((((((.(((((.(((((....((((((((((((..((((((((((....))))...,......{{{.............))}...........))))))))))),}))))..))....,))))).))))).)))))))),,.,.((((.{.((((((((......((((...})}})))))))).).)))),.))))))))......))))))}..)).))))))).)))},,|,..},....))..))))))))),,})))}{{{.((((..,..(((((((({....((((((.(((...((((((((((...))))))........)))}))).)))))),.....((((((.((.(((((.((((.(((..{{.(((((((..((((.(((,.{((.((({(((...}))))}))))))))..((((((((.((((.....(((.(((...)))))).((.(((((((((((((..((,(((((((((((((((.(((,(((((..........))))).,,})).))))((((((((...((((((.........))).))).)))))))).)))))...))))),.|{.{{{(((|....|))))},,,.((((((((((...)))))))))).}),)))))))))....)))).))))))..))))))))((((((..(((.(((......))).)))....)))))).......,.(((((((..((((((.(((..............{(((((..((((.(((((((,.((....}}.,.}))).(({...{{.......},,....))).))).))))})))))((((...(((.(((.......))).)))...))))........{({,(((...))).}))....(((((...))))){(((((.......)))))))))))))))..))))))).,(((.....))))))).)))))))}}..,})).)))).))))))).)))))){{{{((({...|{{|{,....,},)))))}}}}}}},.......(({{{.{{{....,..))}...}}}))}}}),.))))).}..)))),}}}}.))))))))).)).)))).}...,....)))..))))..))))))))...............))))..)))))..

Transcripts

ID Sequence Length GC content
CCUUUCGGUCCAGGCGGCGGCAGGGCUGAGCCAGCGACGCCCUCCAUUC… 1451 nt 0.6072
Summary

This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein is implicated in the function of the permability transition pore complex (PTPC), which regulates the release of mitochondrial products that induce apoptosis. The human genome contains several non-transcribed pseudogenes of this gene. [provided by RefSeq, Jun 2013]

Forensic Context

A study in human blood plasma demonstrated that the SLC25A6 (antithrombin-III) was significantly downregulated with age and was used as part of a proteomic signature for chronological age prediction [Salignon et al. DOI:10.18632/aging.204787].