| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCCGGGCGGGGCGCGAGCAGAGACAGGUCAUGGCAGCGCCAGGCGGC… | 4737 nt | 0.4036 |
Mutations in this gene are associated with Pendred syndrome, the most common form of syndromic deafness, an autosomal-recessive disease. It is highly homologous to the SLC26A3 gene; they have similar genomic structures and this gene is located 3' of the SLC26A3 gene. The encoded protein has homology to sulfate transporters. [provided by RefSeq, Jul 2008]
A study in zebrafish demonstrated that the SLC26A4 transcript, a solute carrier family 26 anion exchanger member 4, increased in relative abundance within 0.3 hours postmortem [Pozhitkov et al. DOI:10.1098/rsob.160267].