| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCCUGCCCGGAACCCCCGGCAACGCGCAUACGACUACACCUGCUCCG… | 2225 nt | 0.4903 | |
| AGUCCUGCCCGGAACCCCCGGCAACGCGCAUACGACUACACCUGCUCCG… | 2384 nt | 0.4887 |
The protein encoded by this gene is an isozyme of long-chain fatty-acid-coenzyme A ligase family. Although differing in substrate specificity, subcellular localization, and tissue distribution, all isozymes of this family convert free long-chain fatty acids into fatty acyl-CoA esters, and thereby play a key role in lipid biosynthesis and fatty acid degradation. This isozyme activates long-chain, branched-chain and very-long-chain fatty acids containing 22 or more carbons to their CoA derivatives. It is expressed primarily in liver and kidney, and is present in both endoplasmic reticulum and peroxisomes, but not in mitochondria. Its decreased peroxisomal enzyme activity is in part responsible for the biochemical pathology in X-linked adrenoleukodystrophy. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2009]
A study in humans demonstrated that the SLC27A2 gene, involved in lipid and fatty acid metabolic processes, was the most downregulated transcript in subcutaneous adipose tissue of heavier co-twins from BMI-discordant monozygotic twin pairs, with a fold change of 0.1848 [Muniandy et al. DOI:10.1038/ijo.2017.95]. Subsequent multiomics research in human adipose tissue from similar twin cohorts confirmed the downregulation of the SLC27A2 in heavier individuals, associating this molecular change with broader mitochondrial dysfunction and altered lipid metabolism in acquired obesity [van der Kolk et al. DOI:10.1016/j.xcrm.2021.100226].