Basic Information

Symbol
SLC2A3
RNA class
mRNA
Alias
Solute Carrier Family 2 Member 3 GLUT3 Solute Carrier Family 2 (Facilitated Glucose Transporter), Member 3 Solute Carrier Family 2, Facilitated Glucose Transporter Member 3 Glucose Transporter Type 3, Brain GLUT-3
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Other applications

MANE select

Transcript ID
NM_006931.3
Sequence length
3827.0 nt
GC content
0.4549

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1177.60 kcal/mol
Thermodynamic ensemble
Free energy: -1250.04 kcal/mol
Frequency: 0.0000
Diversity: 1044.57
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.((((....(((((((.....(((....)))(((((..(.((.((......(((((......(((((((.((..((((((.(((((.......(((((.(((((........)))))(((((...)))))(((((((.((....(((((..(((((..((((.((.....))...))))......(((((((.((((.(.(((((.((((((((((((((((....)))....((((((((((.(((((((((((((((.(((((....)))))(((.......)))(((((((((((....((..((((......))))..))..............)))))))))))......))))))..))))))))))))).))))))...((((.((((......(((((..(((..(((.(((.((.........((((.(((((....))))).))))....(((((((((((((......))))))))))))).((((((......))))))..)).)))))).)))..)))))....))))))))....(((((.....)))))........))))))))))....)))...(((((.((((((((((...))))))))......)).)))))..))))).).)))).)))))))(((((((...))))))).......((((((..((((((((...(((((((....((((((.....((((((((((......((((((..((((((.(((((..(((((((((....((((((((((((((........))))))....(((((...(((...)))..))))).(((.((((((((((((...((((((........)))))).((((((((..((((...(((((....)).))).......((..(((...(((((.((((((....)))).)).))).)).))).)).)))).))))))))...)))))))).......)))).))).)))))))).....(((((((((.....................)))))))))(((((....(((((((((.((((......)))).))))).)))))))))....((((((((((.....))))....)))))).))))))))).)))))...)))))).)).))))....)))))))))).............((((((..(((((.....((((((....))))))...))))).))))))...........(((((((....((((((....................)))))))))))))...)))))).....)))))))..))))))))))))))...(((.(((.((((....))))))).)))..(((((.(((((............))))).)))..))...)))))..)))))....))))))))).(((..(.((((((((((((.(((((....(((.....(((((..(((((......((((((((((((.((..........)))))).))))))))........)))))...)))))..)))....))))).))))))...)))))).)..))).((((....))))))))).........))))).))))))..))..)))))))..((((((((.....(((..(((((((.(((........)))..((((((((.....)))))))).........(((((...((((((.((........)).((((......(((.....((.....((((..((.((.......)).)).))))...))..))).......))))...............)))))).)))))((((((....))))))....(((((((......)))))))..))))))).)))......)))))..)))......(((.(((((((((((((.........(((((.((......)).)))))))).))))))))))..)))))))))).)))..)))))..)))))))...))))...........(((((((((..(((((((((((......)))))))))))...)))))))))..)))).(((((((((((((((.(((................))).)).)))))).((.(((((((.((((..(((...(((..((((((((.(((((((..(((((((....)).))))).))))))).))).(((((.(((((((((((((.((((((((((((....)))...............(((((...(((((((.((((.(((((.......(((((((((.(((((................(((((((.((.(((((....((.((((((.(...........(((((((........)))))))...).)))))).))))))).)))))))))......(((((((.....)))))))))))).)))))))))...(((((((.(((((((......((((((.((((......))))))))))((((((.((((..(.(((...((.(((....))).))..(((....(((((((((((..((....))..)))))))))))....)))(((((((...(((((((((.((((((((((.((...................)).))))).....)))))..........((((....((((((...))))))...))))...((((((..........))))))...)))))))))..)).)))))((((((((.((.((((....)))).))))))))))...))).)..)))).))))))...))))))))))))))..((((.....))))............(.(((((((...(((..((((...))))..)))))))))).).)))))..))))((((((((........(((((((((.........(((((((((((.(((...)))..))))))))))).....((((((..(((.((......(((........(((.(.(((...))).).))).......)))......))))).))))))....(((.(((.((((((((((....(((.((.(.....).)))))...))))))).))).)))))).(((.(((((((.((((....)))).))))))).(((((........))))).)))..........)))))))))....))))))))......(((....))))))))))..)))))(((((((...(((((...)))))...))))))).......((((((((..(((((((((((((.(((.............((.....))((((((((....))))..))))((((((...((((((....))))))....)))))))))(((((((((((...))))..)))))))..((.(((((..(((((((((..((......((........))(((((((........)))))))...((((((....))))))))..)))))))).)..)))))))...)))))).)))))))..)))))))).((((...(((....))).)))).((((.(....).))))(((((...)))))..............((((((.........))))))....)))))))))((.((((((((..(((..((((((((((((..........))).)))))))))..)))))))))))))..(((((...)))))....))))))))))))))))))...............)))))..))).)))..)))).))))))).))..))).)))).
Thermodynamic Ensemble Prediction
{(((.((((,,..(((((((.(({,((((((((((((((,,.((((((....,|{{{{{{,,||{||||,..,,{{,{((({{,,{{{(({.{{{{{((({,.(((((........)))))......,{(((((.((.({,,(((({.((((..(((((,..,,,,,{({{,{{{(((...(((((...((((..(((((((..(((((((((.....,,,..,{{|,..,,.....(((((((((,,(((((((((((((({.,{{{{,...,}},,,,,......,}}}(((((((((((....((..((((....,,}}}}..}).,,..,,....,}}))))))))))).,....))))))..))))))))))))).))))))...,,,|.,}||,....{|||..{({,,,,}}.,)))}.........))))))))))))},))))))))))))))))||||(((((((((,,..{{|||,|||||||,,.{(((((......)))))|((((((({(((((({.,,(((.(((((..((((.(((.((((({...,))))){{{,{,.{.{((((({{..{{,({(.((((((.{{,((((((((...)))))))),...(((((((((.,{......,|}.....((.((((((((((...)))))||,.....,||{{{({.((((((((.{.(((((((....((((((.....((((((((((......((((,,..((((((.(((((..(((((((((....(((((((({(((((........)))))}....(((((...(((...)))..))))).(({.((((((((((((...((((((........)))))).((((((((..((((.,.(((({....}).))).......{{..(((...{{(((.({((((....)))).}).))).}}.))).}},)))).))))))))...)))))))).......}))).))}.))))))))...,.(((((({{{....,,....,|,||,,,...}))))}}}|(((((....(((((((((.((((......)))).))))).))))))))),...{{{{{{{{{{.....}}}}...,)))))}.))))))))).)))))...)))))).)}.))))....)))))))))).............((((((..(((((.....((((((....))))))...))))).))))))...........(((((((....((((((...,..........,.....)))))))))))))...)))))).....)))))))..))))))))))}))))).)}))))))))),}..))))))))},))}}.)))))),|||...{{|.{{{..,.))).))}.,(({.,{{,.{((({,,{{({.{{....}}}}||,..{.{{{{{{{(((((.(((((..,.(((.....(((((..(((((......(((((((((((({((...,,...,,)))))))))))))))........)))))...)))))..))).,..))))).))))))...})))}},),.)))}}},}))}|,,|},.}})),,))).))))..))))).}}}..})))),}.}},.,|{((({(...,,.,...........))}}))||,.,,,),.((((((((.....)))))))).{{{....})).,),}))))))}.{|,,,,,...}}.}}}}}}}.................},}}}.}}}}})))},)))))..)))).)))))))).)))))))))}))))}}}}........,{{{{{{{.,...(((((({....))))))).|}|||||}}},.,}})))},})}}))))))}}{{(((...,))}.,,....{(((.{(((.(((((((((((((.........(((((.((......)).)))))))).))))))))))..)))}.))))...,},,,}..)).)))))))...))))...........(((((((((..(((((((((((......)))))))))))...))))))))).,||}}.(((({{{((((((((.(((..,.,........,..))).))}}}}}}}.({.(((((((.((((..(((...{((..((((({((.(((((((..(((((((....))},)))).))))))).}}}.((((|{(((((((((((((.{(((({{(({,,....|}}.............,{({{(({{{|{(((({{{(((,(({((((..,..(((((((((.(((((................(((((({{((.(((({...,((.((((((.(...{{{{{{{,,{(({{{....}}},)))))))}..).)))))).))))))).)))))))))..,...{((((((.....))))))}))))).)))))))))...{{{((({.{{(((({......{(((((.((((......)))))))))},{{(({.,(((,.,.((({{,(,.{{{,,,,})),}}..|||},,,(((((((((((.,({....,,..))))))))))),,,,}}|(((((((.,.{((((((((.{(((((((({.((...,,..,,,...,,..,})).)))))....,))))},.......|,(({{..,.{({{{{...}})))|...)))),..((((((..........))))))...))))))))),.})}}})))|{{{{{{,{({,({((....)))).}}}}}})))},,,}},.,},)))}.)))))},,.}))))}}}}}}}},..{{((.....}))},,}}}|||....|}|{(((((...(((..((({...,)))..)))))))))},|,|||||,{|,|.((((((((........(((((((((....,,...(((((((((((.(((...)))..))))))))))){{{({(({{{(..((({({.....}|||}...,,,,,{,.,.(((...}))},.|||,|,,,..})}....,,}}))).)))))},}}}|((.{{{.{{{{{(((((,,..(((,{,,{,,,,,|||,}}}..,}}})}}}.})},}}}}}}.|||,|{{{|||,((((....)))).))))))),|{|||,..,....}))))}}}}......}}},}))))))))..,,}})))))).,}},}|||.,,,}})})}}},,..}}}}}|((((((...(((((...)))))...))))))},,,,|,,{(((((((..(((((((((((((.((,{{{......}},.||..,.,||({,{((((....)))),|}}},((((((...((((({....})))))....})))))}))(((((({((({...})))..}))))))..((.(((((..(((((((((..((......((........))(((((((........)))))))...((((({....})))))))..)))))))).)..)))))))...)))))).)))))))..)))))))|,({{{..,||{.,,,))),}))}.{(((|,....),))))(((((...)))))...........,,.((((((.........)))))).},.}}}}||||,((.((((((((..(((..((((((((((((..........))).)))))))))..))))))))))))).||||{{.,,))))),...))))))))))))))))))...............}))))..))}.)))..)))).))))))).}).,))).)))).

Transcripts

ID Sequence Length GC content
AGAGAUGCUGUAAUGGUAAGACUUUGGAUCCUUCCUGAGGACGUGGAGA… 3827 nt 0.4549
Summary

Enables D-glucose binding activity; dehydroascorbic acid transmembrane transporter activity; and hexose transmembrane transporter activity. Involved in D-glucose import across plasma membrane; galactose transmembrane transport; and transport across blood-brain barrier. Located in aggresome and plasma membrane. Biomarker of Alzheimer's disease; acanthosis nigricans; diabetes mellitus; and type 2 diabetes mellitus. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in humans demonstrated that the SLC2A3 gene shows a significant difference between burn patients and controls (a main burn effect) at both early and middle time points post-injury, with no age effect observed, classifying it into a group of genes with a main effect of burn [Zhou et al. DOI:10.1073/pnas.1002757107]. In a separate scoping review of human twin studies, the SLC2A3 gene, identified as glucose transporter 3 (GLUT3), was found to have increased mRNA expression in placental samples and human umbilical vein endothelial cells of smaller twins with fetal growth restriction, where its expression was negatively correlated with birth weight [Dany Laure Wadji et al. DOI:10.1371/journal.pone.0315549].