| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGAUGCUGUAAUGGUAAGACUUUGGAUCCUUCCUGAGGACGUGGAGA… | 3827 nt | 0.4549 |
Enables D-glucose binding activity; dehydroascorbic acid transmembrane transporter activity; and hexose transmembrane transporter activity. Involved in D-glucose import across plasma membrane; galactose transmembrane transport; and transport across blood-brain barrier. Located in aggresome and plasma membrane. Biomarker of Alzheimer's disease; acanthosis nigricans; diabetes mellitus; and type 2 diabetes mellitus. [provided by Alliance of Genome Resources, Jul 2025]
A study in humans demonstrated that the SLC2A3 gene shows a significant difference between burn patients and controls (a main burn effect) at both early and middle time points post-injury, with no age effect observed, classifying it into a group of genes with a main effect of burn [Zhou et al. DOI:10.1073/pnas.1002757107]. In a separate scoping review of human twin studies, the SLC2A3 gene, identified as glucose transporter 3 (GLUT3), was found to have increased mRNA expression in placental samples and human umbilical vein endothelial cells of smaller twins with fetal growth restriction, where its expression was negatively correlated with birth weight [Dany Laure Wadji et al. DOI:10.1371/journal.pone.0315549].