| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUCUUUUCCCCCAGCCCCGCUCCACCAGAUCCGCGGGAGCCCCACUGCU… | 3375 nt | 0.5677 |
This gene is a member of the solute carrier family 2 (facilitated glucose transporter) family and encodes a protein that functions as an insulin-regulated facilitative glucose transporter. In the absence of insulin, this integral membrane protein is sequestered within the cells of muscle and adipose tissue. Within minutes of insulin stimulation, the protein moves to the cell surface and begins to transport glucose across the cell membrane. Mutations in this gene have been associated with noninsulin-dependent diabetes mellitus (NIDDM). [provided by RefSeq, Jul 2008]
A scoping review of human twin studies found that muscle expression of the SLC2A4 was positively associated with birth weight, indicating a link between early growth and later metabolic gene regulation [Dany Laure Wadji et al. DOI:10.1371/journal.pone.0315549].