Basic Information

Symbol
SLC2A4
RNA class
mRNA
Alias
Solute Carrier Family 2 Member 4 GLUT4 Solute Carrier Family 2 (Facilitated Glucose Transporter), Member 4 Solute Carrier Family 2, Facilitated Glucose Transporter Member 4 Glucose Transporter Type 4, Insulin-Responsive GLUT-4 Insulin-Responsive Glucose Transporter Type 4
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_001042.3
Sequence length
3375.0 nt
GC content
0.5677

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1352.30 kcal/mol
Thermodynamic ensemble
Free energy: -1409.36 kcal/mol
Frequency: 0.0000
Diversity: 831.43
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((.(((((((((((.......((((((..(((((((((.((((((.....(((((((((((.(((((..((((((((....))))))))..))))).))))....)))))))....(((((.(((((...)))))....)))))((((((...))))))(((...(((((((.((((((((..(((((((((((((..(.(((....))))..)))).)).)))).............)))..))))))))))))))).)))..((((((((.((((((....)))))))))))))).......))))))...))))))).)).))))))......(((((((((..............(((((((((.((((..(((((.....((((((((...((((.((.((((((((((((((..........))))).))))).))))..)).))))..((((((....(((((((......(((((((.(((((((...(((((((((((((((((........).))))))...)))))))...))).))))))).))).((((((.(((((.(((((((((((((((..(((.(((...))).)))..))))))))))(((((.(((((.((((((((.((.((((((..(((((((.(.((((....((((..((((....))))))))..(((((((......)))))))...)))).)))))))).)))))).........((((((((((.(((((.(((..((((......))))((((((((..((.((((((.((((((((.(((((((...)))((((((((((((((((..(((.((((.((((......)))).)))).)))(((((((((((((.(((((((....))).((((....((.....)).....))))(((((((((((.....))))..))((((...)))).)))))((((((...((((((((((((.(((((.((.((((...(((((.(((((((((.(.((((...)))).).)))))))))))).((((.((((.......)))).)))).........))..)))).)).))))).)))))))).))))..)))))).((((((...((........)).)))))).)))).))))).))))))))((((((...((((((....)))))).))))))(((.....)))...(..((((........))))..)..(((((((((..(((....)))..)))))))))....)))))))).))))).))))))).)))))...((.(((.(((.(((((.(((((....)))))))))).))).))).))........((((.(.(((((....))))).)))))........(((.((((((.(((..(((.....)))....))).)))))).)))..)))..)))))))).)))))))))))))))).)))))))))))))))))..))).)))))..)))))....))))).)....)))).)))))))))))))))))))))))))))))))..........((((.....))))..))))).))))...)))))))))..(((((.(((((..((.(((((.(((.((((............(((((((((((........(((((((...)))).))).(((.((((((((((((.....(((......((((.((.(((((...((.(((((((...(((..(((((((((((....))))).)))))).)))(((((.............)))))(((((((((..((((..((((((.(((....(((((((((......))).....))))))...))).))))))..))))..))))))..))).....))))))).))..))))).)).))))......)))....))))))).))))).)))((((((.........))))))(((..(((...((((((((((...((((((((((((..................((((...((((....))))..))))..)).)))))))))).)))))))))).)))...))).....(((((((((....(((((...(.(((.((..((((((((..........))))))........))..)).))).)....)))))...)))))))))..((((((((((((.....((((((.................................((((((((((((((((((.(((...(((((.(((.((((((((((((.(((((......)))))(((.....)))..)))))))).....)))))))))))).))))).))).))))))...(((....))).......(((((((((......(((((.........))))).(((...)))..)))))))))....)))))))..(((((.((((.......((((((((((((((.....)).))))))....((((((((......))))))))....((((((.....((((...(((....)))...)))).....))))))....))))))...((((....))))..))))...))))).......))))))))))))))))))))))))).))))))))))).))))).))..)))))))))))))))))))((((((..((((.(((.((((((........))))))(((((((....((((...(((((...))))).))))..((((.((......))))))))))))).......))).))))))))))...)))))))).)))((((((((...(((((.((..(.(((....))).)..)).)))))....))))))))....(((((.....)))))..((((((....))))))..(((.(((.((((((...((.(((((((((((((((.((((((...((((.(.(((((((...........................)))))))).))))...)))))))))))......((((((((((((..((..((((((.((((..((...((((...(((((........)))))..............)))).))..))))..)))))).))...)))))))..)))))..(((((...)))))...(((.(((((((((.......))))))..))).)))))))))))))))..)))))).))).)))...(((((.(((..((.((...(((((...((((........))))...))))).))))....(((........))).))).)))))...((((((............))))))..)))))....
Thermodynamic Ensemble Prediction
((((....((((.(((((((((((((({((((({(((((({.{{{{||,,,,,|||||{{((((.(((((..((((((((....))))))))..))))).)))),.,,||||||}....(((((.(((((...)))))....)))))((((((...))))))(((...(((((({{((((((((..((((((({(((((..(,(({....}))),.))))}}).}))),........,...)))..))))))))))))))).)))..((((((((.((((((....)))))))))))))).......))))}|...}))}}}}.)}.....))),,|||{{{,(((({{,....,)))))....(((((((..{,.,..((((((........))))))((({.((.((((((((((((((..........)))))},)))).))))..)).))),.,((((((...,.((((((((........(((,((((({(...(((((((((((((((((........,,))))))...)))))))..,))).}||||||,|}|{{{{{{.{({(((({{{((((((((((((..(((.(((...))).)))..))))))))))}.|...||}|||...{(((..((.((((((..(((((((.(.((((...,((({..((((....))))})))..(((((((......)))))))...)))).)))))))).))))))...))..)))}..)).))))}}}}}|||}}},|||,,.||{||{|.,,,|||{{.{{||||||.,,.)))})))}))))}},)))))))).}.....)))))},.(((.((((.((((......)))).)))).)))(((((((((((((.(((((((....))}.((((....,,.....}}.....))))(((((((((({..,.,|}}}..}}{{||...,))).)))))((((({...((((((((((((.(((((.((.((((...((((,{(((((((((.(.((((...)))).).)))))))))))).((((.((((.......)))).)))).........))..)))).)).))))).)))))))),))))..)))))).((((((...((........)).)))))).}))).))))).))))))))((((((.,.((((((....)))))),))))))(((.....))).,}}.))))))))}})})))})),},)))))))))))))))))....)))).(((((((((.((((...((.(((.(((((.(((((((((((((((((((..((.((((.{.(((.{.((((((.((((.((((((((.(((..{,,.(((,,(.(((((....))))).))))),.......|,|.,.(((((((((.......((((({,......))))))).......))))))).}}...},}))}))))))))))).)))).),..))))).}.))),)))).)).))))))..)).))))(((((((((.(((((((((((..,.(((((((((.(({(({.((((...{,.(({{{{||(((({((,{,,,{,{,,{({,,{{{{,.,,{{{,...,,,.,,,,||||||((..{.,,{,.,,|...,,,,}})}}.,,...,}}....}},||||,..}))),))))))}}}}}))))))).)))}...))).}}.)))))))......,...,...{((((({{.(((..(((((((((((....))))),)))))).)))..}.}.))))))))...))))))))))).......((((((..(((.....(((((((((((....(((((((({((((,((((((..,(((((((((((((((((((.(((......))))))}..,))))|{{.{{{,.,(((({,|..,,.....,.{(((.(((((((.({{({((({,..,,|,|||}}}}..,.,||{,|,((((((((((...(((((((((({(,.............,...((((...((((....})))..))))..,)})))))))))).)))))))))}.}}|,,,,|{{{.,,,,}}||)},)}}}))).})})})}}}.||.,)}{||||,..,....}}}))))))}},{,...})|.....{((({.....))))).,,||,..,...((((((((((((.....((((({.,||{,{{{,,,......................,{{({,{{||||{(({{.{((,,,(((((.(((.((((((((((((.(((({...,,.))}}}{{|.....)))|.}))))))).....}))))))))))|.}||||.,||||||,,,.,,((({,,,{|,.{,....(((((((((......{((((.......},)}}}|.(((...)))..)))))))))...|||{.|{{{{.,..},,,}}),}}}},}||||{|{||||{{||,..}}.}})))),...{(((((((......))))))))}}},}})||(((((((((((.{(({(((((,({..,((,....,}))),)}.))))))||...||||....)))))))))))))),))},,,},,,)))))})))))))))))),|||||{{.(,.{((({{{.|||,.,,|}|{(((((..,,.}}}}},,))},))))))}.)))}}},{,,||||,,....),))))))}...((((((...)))))).))))),....,,}}||((((.((......)))}))),))))))))......)))))))))))....)))..)))))).((((((((...(((((.,{..(.(((....))).)..,,.)))))....))))))))....(((((.....)))))..((((((....))))))..(((.(((.((((((,,,((((((......{(((((.{(((((,.{((((,({({(((((,..........................},,})))),)}))}},))))}},))))},.,,}}}},))))))..,,}....((((((((.(({,,,,,,,,,..,(((((........))))),.||{,{,.....,),}}{(((.((((((((({...))}),})))))).))))....(((({.,,|}))),,.(((.{{,((((((.,...,.))))))..})}.}})}.))))))))))}.)))))).))).)))...))))))))).(((((.......)))))(((...)))))))))).))))).))).))..)))}.........,.({({{......}}}}},,......,},.)))))))))............

Transcripts

ID Sequence Length GC content
GUCUUUUCCCCCAGCCCCGCUCCACCAGAUCCGCGGGAGCCCCACUGCU… 3375 nt 0.5677
Summary

This gene is a member of the solute carrier family 2 (facilitated glucose transporter) family and encodes a protein that functions as an insulin-regulated facilitative glucose transporter. In the absence of insulin, this integral membrane protein is sequestered within the cells of muscle and adipose tissue. Within minutes of insulin stimulation, the protein moves to the cell surface and begins to transport glucose across the cell membrane. Mutations in this gene have been associated with noninsulin-dependent diabetes mellitus (NIDDM). [provided by RefSeq, Jul 2008]

Forensic Context

A scoping review of human twin studies found that muscle expression of the SLC2A4 was positively associated with birth weight, indicating a link between early growth and later metabolic gene regulation [Dany Laure Wadji et al. DOI:10.1371/journal.pone.0315549].