| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAACUGACUCGGAGCGAGGAGACCCGAGCGAGCAGACGCGGCCCUGGCG… | 1723 nt | 0.4689 |
Enables copper ion transmembrane transporter activity. Involved in copper ion import. Located in late endosome membrane; lysosomal membrane; and plasma membrane. [provided by Alliance of Genome Resources, Jul 2025]
A study in domestic swine demonstrated that the SLC31A2 exhibited opposite regulation in myocardial infarction, showing induction in the border zone but repression in the ischemic zone of the heart [Kaikkonen et al. DOI:10.1161/CIRCGENETICS.117.001702]. In a separate single-cell transcriptomic analysis of radiation-induced lung injury in rats, the SLC31A2 was identified as an orthologous gene associated with inflammatory processes [Shi et al. DOI:10.17305/bb.2024.10357].