| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUGCACUAGCCACCACCGCCGCCGCCGCCGCUCCGCCAGACCUGCUGC… | 2550 nt | 0.6122 |
The protein encoded by this gene is an integral membrane protein involved in gamma-aminobutyric acid (GABA) and glycine uptake into synaptic vesicles. The encoded protein is a member of amino acid/polyamine transporter family II. [provided by RefSeq, Jul 2008]
A study in humans analyzing postmortem midbrain tissue from chronic cocaine abusers and controls identified a molecular signature of differential gene expression, with transcript abundances for approximately half of these genes being diagnostic for cohort assignment with accuracies ranging from 76% to 93% [Bannon et al. DOI:10.1038/Npp.2014.70].