| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUGGGGUGUGCGCAGCGCCUGGAGCAUGAGCCGGGUGGUGGCGUGCAC… | 3791 nt | 0.3785 | |
| ACUGGGGUGUGCGCAGCGCCUGGAGCAUGAGCCGGGUGGUGGCGUGCAC… | 3983 nt | 0.3816 |
SLC38A4 is found predominantly in liver and transports both cationic and neutral amino acids. The transport of cationic amino acids by SLC38A4 is Na(+) and pH independent, while the transport of neutral amino acids is Na(+) and pH dependent (Hatanaka et al., 2001 [PubMed 11342143]).[supplied by OMIM, Mar 2008]
A study in mice and zebrafish demonstrated that the SLC38A4 transcript, a sodium-coupled neutral amino acid symporter, increased in relative abundance within 0.5 hours postmortem [Pozhitkov et al. DOI:10.1098/rsob.160267]. This finding was part of a broader investigation into postmortem transcriptome dynamics, which identified 1063 genes with significantly increased transcript levels after death in zebrafish and mouse, revealing a step-wise shutdown process with functional categories including transport, stress, immunity, inflammation, apoptosis, development, epigenetic regulation, and cancer.In a separate investigation using rat liver tissue, the SLC38A4 was identified as an amino acid transport system A3 and was found to be down-regulated on day 1 following a 20% total body surface area burn injury [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025].