Basic Information

Symbol
SLC40A1
RNA class
mRNA
Alias
Solute Carrier Family 40 Member 1 IREG1 FPN1 FPN SLC11A3 MTP1 HFE4 Solute Carrier Family 11 (Proton-Coupled Divalent Metal Ion Transporters), Member 3 Solute Carrier Family 40 (Iron-Regulated Transporter), Member 1 SLC40 Iron Transporter Iron Regulated Gene 1 Ferroportin Iron-Regulated Transporter 1 Ferroportin 1 Ferroportin-1 MSTP079 MST079
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Mechanical injury analysis

MANE select

Transcript ID
NM_014585.6
Sequence length
3330.0 nt
GC content
0.4141

Transcripts

ID Sequence Length GC content
GGCGGCGGCGGCGGCGGAGAGAGCUGGCUCAGGGCGUCCGCUAGGCUCG… 3330 nt 0.4141
Summary

The protein encoded by this gene is a cell membrane protein that may be involved in iron export from duodenal epithelial cells. Defects in this gene are a cause of hemochromatosis type 4 (HFE4). [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that the SLC40A1 was downregulated in common in spleen leukocytes across all three injury models of trauma/hemorrhage, burn, and LPS infusion at the 2-hour post-injury time point [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005]. A study in humans demonstrated that severe trauma induces a unique bone marrow transcriptomic signature, characterized by the upregulation of genes encoding known inhibitors of erythropoiesis, including the SLC40A1, alongside interleukin-6 receptor, transforming growth factor-beta receptor, and interleukin-10, as well as genes involved in innate immunity such as toll-like receptor 4 and its signaling adaptor MyD88 [Kelly et al. DOI:10.1097/SHK.0000000000001826]. This transcriptional response in trauma patients was distinct from that observed in elective hip replacement patients and was associated with elevated plasma hepcidin levels.