| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGCGGCGGCGGCGGCGGAGAGAGCUGGCUCAGGGCGUCCGCUAGGCUCG… | 3330 nt | 0.4141 |
The protein encoded by this gene is a cell membrane protein that may be involved in iron export from duodenal epithelial cells. Defects in this gene are a cause of hemochromatosis type 4 (HFE4). [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the SLC40A1 was downregulated in common in spleen leukocytes across all three injury models of trauma/hemorrhage, burn, and LPS infusion at the 2-hour post-injury time point [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005]. A study in humans demonstrated that severe trauma induces a unique bone marrow transcriptomic signature, characterized by the upregulation of genes encoding known inhibitors of erythropoiesis, including the SLC40A1, alongside interleukin-6 receptor, transforming growth factor-beta receptor, and interleukin-10, as well as genes involved in innate immunity such as toll-like receptor 4 and its signaling adaptor MyD88 [Kelly et al. DOI:10.1097/SHK.0000000000001826]. This transcriptional response in trauma patients was distinct from that observed in elective hip replacement patients and was associated with elevated plasma hepcidin levels.