| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAACGAGUGGGAACGUAGCUGGUCGCAGAGGGCACCAGCGGCUGCAGG… | 4954 nt | 0.5618 |
The protein encoded by this gene is part of the anion exchanger (AE) family and is expressed in the erythrocyte plasma membrane, where it functions as a chloride/bicarbonate exchanger involved in carbon dioxide transport from tissues to lungs. The protein comprises two domains that are structurally and functionally distinct. The N-terminal 40kDa domain is located in the cytoplasm and acts as an attachment site for the red cell skeleton by binding ankyrin. The glycosylated C-terminal membrane-associated domain contains 12-14 membrane spanning segments and carries out the stilbene disulphonate-sensitive exchange transport of anions. The cytoplasmic tail at the extreme C-terminus of the membrane domain binds carbonic anhydrase II. The encoded protein associates with the red cell membrane protein glycophorin A and this association promotes the correct folding and translocation of the exchanger. This protein is predominantly dimeric but forms tetramers in the presence of ankyrin. Many mutations in this gene are known in man, and these mutations can lead to two types of disease: destabilization of red cell membrane leading to hereditary spherocytosis, and defective kidney acid secretion leading to distal renal tubular acidosis. Other mutations that do not give rise to disease result in novel blood group antigens, which form the Diego blood group system. Southeast Asian ovalocytosis (SAO, Melanesian ovalocytosis) results from the heterozygous presence of a deletion in the encoded protein and is common in areas where Plasmodium falciparum malaria is endemic. One null mutation in this gene is known, resulting in very severe anemia and nephrocalcinosis. [provided by RefSeq, Jul 2008]
A study in human body fluids demonstrated that primers targeting transcript stable regions (StaRs) for the SLC4A1 enabled detection in degraded menstrual blood and provided more consistent, higher signal detection in degraded circulatory blood where conventional primers failed or were inconsistent [Lin et al. DOI:10.1016/j.fsigen.2015.09.012]. A subsequent human study using a combined mRNA/miRNA multiplex assay found the SLC4A1 mRNA was detected specifically in all fresh blood and most menstrual blood samples but was less sensitive in dilutions and was not detected in degraded samples, whereas miRNA markers showed superior detection in degraded material [Bamberg et al. DOI:10.1016/j.fsigen.2022.102707]. A review of forensic proteomics literature notes that the SLC4A1 is used in combination with other markers for accurate peripheral blood identification in human samples [Alex et al. DOI:10.1016/j.scijus.2025.101320].