| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGCUCACUCUGGCAGGUAGGAACAGGGGAGAGUGCACCUGCUACCAGUC… | 4536 nt | 0.3710 |
This gene encodes a member of the solute carrier family 6. Members of this family are sodium and chloride dependent neurotransmitter transporters. The encoded protein transports both neutral and cationic amino acids. This protein may also function as a beta-alanine carrier. Mutations in this gene may be associated with X-linked obesity. A pseudogene of this gene is found on chromosome X.[provided by RefSeq, May 2010]
A study in humans demonstrated that within monozygotic twin pairs, the heavier co-twin had significantly higher serotonin transporter (SERT) binding in the hypothalamus/thalamus compared to the leaner co-twin, an effect driven by women [Koskela et al. DOI:10.1016/j.physbeh.2007.11.043].