Basic Information

Symbol
SLC6A17
RNA class
mRNA
Alias
Solute Carrier Family 6 Member 17 NTT4 Sodium-Dependent Neutral Amino Acid Transporter SLC6A17 Neurotransmitter Transporter 4 Orphan Sodium- And Chloride-Dependent Neurotransmitter Transporter NTT4 Solute Carrier Family 6 (Neutral Amino Acid Transporter), Member 17 Solute Carrier Family 6 (Neurotransmitter Transporter), Member 17 Sodium-Dependent Neurotransmitter Transporter NTT4 Solute Carrier Family 6, Member 17 MRT48
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_001010898.4
Sequence length
6419.0 nt
GC content
0.5819

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2699.20 kcal/mol
Thermodynamic ensemble
Free energy: -2802.96 kcal/mol
Frequency: 0.0000
Diversity: 1663.42
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((.....)))(((((((((((((((.((((((....((((.(((((((((...)))))).))).))))...((((.(((((.(((((((.(..((.(((((.........(((((((.((.......))))))))).))))).))..).)))))))))))).)))).))))))(((((((((((((((((((((((((.(((.((((.(((.(((.((((((.((((.((((((.((((((....)))))).))))))..)))).))...(((((.(((((((((((.((.((((((((.(((((((.((((.(((....))).))))))))))).)))((((.(......).)))).((((.....)))).))).)).)).)))))))))))...((((((((((((....)))))........)))))))...((((..((((((((.((((((((.(((((((((((....))))............((((((.....(((..(((....)))..)))))))))((((((.((((..(((((((.((((((.((((((((.(((((((..((((...........(((.((((((.((((((((((((..((((..(((((.((.(((((.((((((((((((((((((((.((((.(((...(((........))).))).))))..).)))).))))))))((((..(((......((((((((......))))...(((......)))(((((((((((((((((((((.(((((((((((((((((....)))(((....))).((((.....))))...((.(((((((....))))))).))))))))))))).))).))))).....((((((((.....)))))))).........(((((.(((((.........))))).))))).......(((....)))))))).)))))))))))................))))...)))..))))..(((((...((((((..((.(((((..(((((.(((((((((.(.(((..(((((((......((((((....((((.......))))(((.((((((((..((.(((((((.......))))))))).))))))))...)))..((((..((.(.(((.......)))).))..))))..((((((((.((((......)))).))).)))))((((((((.(..((......))..).)))))))).....((((((((((((((..((((((((((((.((.((((((((((((((.(((((.((((........((((((((....)).)))))).((((..((((..(((((.((((((.(((((((...(((((((((..........)))))))))....((((((...))))))...(((.(((......))).)))......)))))...))..))))))))))).))))..)))).(((((((....((((((((((((.(((.((((((....))))))..)))......)))))))))..)))..))))))))))).)))))...(((((((.........((((..............((((((...))))))((((((.........((...(((((((..(((........)))......(((((((((.(....((((((((...((((((((((.((((.(((..((((((.((((((.(((((.((....))))).......)).))))...)).))))))..))).)))))))......))))))).((((.(((((((.(((....((......))....))).)))))))..))))(((((....)))))...(((..((((((((.(((((((((((((((((((((.((.((.((((((....((((.((((..((...))..)))).))))....)))))))).))))))).......((...(((((..((((((((..((((.((((((..((......))..)).....((((((......(((......)))........))))))...(((((((...((.(((((((((((((((..............(((((......)))))...((((((((.((((....)))).....((((((((........))))))))..))))))))...((((.((((((((.....)))))))))))).))))))((((((((...)))))))))))))))))..))..))))))))))))))).))))))........))..)))))...)))))))))...)))))))))........((((...)))))))))))).)))...((((((((((....((((........))))....))))).....))))).....((.(((((......)))))))))))))))..))))))))))....))))))).))))))))))))........)))))))(((((((......))))))).......))))).)))...(((((.....)))))...))))))...))))))))))..)))).))))..((((.(((...)))))))(((((....))))))))))))))).)))))).((((..(((..((..((....))..))..)))..))))...)))))))..))).))))).)).)))(((((((((((......)))))((((....)))))))))).(((.....)))...((((((.(((..((........))..)))))))))((((......)))).(((((((.((((((.....)).))))))))))))))))..))))).)).))))))..))))))))))))))))).....)).)))))...)))).))).......(((......)))....))))))))))))))))))(((((......((((((..(....)..))))))...))))).(((((((....(((..(..((((((((((...))))))))))....)..)))...)).)))))((((((((((((((..((((..(((..((....((((........))))...))..)))..)))).))))))))...))))))))))..)))))))..))))).)))(((....))).))))))...)))))))..))))))))))((((((..(((.(((((((((((((((((((........))))))))....)))).(.(((((((...(((((......)))))..))))))).)((((.....))))..(((((((........)))))))..))))))).)))...))))))))))))).)))))))).).))))))))))).....))))).((((((((.((((((((....(((.((((((((((....((((((..((((((..(((((((((.(((((((((((((((((...((((((((((((((((((((...))))))).((((.((.((..((((((((((((((..........(((((((((.(((.((.......))))).))))).))))(((((...................))))).(((((..(((..((((((((((....)))...((((((...))))))..((((.......))))....(((((((((........))))))))).)))))))..))).....)))))..((((......)))).................((......))...((.((((((...)))))).))...))))))))))))))...))))))))((((......)))).((.((((((......)))))))).))))))))))))).......(((((((((((((...))))))))))))).(((((....)))))((((....))))..(((((.(((((((.....(((((.(((((.((((..(((((....))))).........)))))))))..))))).(((...((..((.(((....))).))..))...))))))).))).)))..)).)))))))))))...))))))..)))..))))))..)))))).(((...(((((...(((((((((((((((((((.((((.((..(((.(..((((.(((.(((((((..((((((.((.(((...((.((((.....(((((.......((((((....)).))))(((((((((((((((........))).)..))))))..)))))..))))).....((((((((((.....))))))))))((((((((((((((.(.(((.(((((((....(((((((((.............)))))).)))....))))))).))).))))))))))))))).))))))...))).)).))))))...))))))).)))))))...).))).)).))))((((((((((((((((((.((((((((.(.....).)))))))).)).......((((((......))))))(((....((((((((((........((((((((.((((.((.......((((((.((((((((...((((.((.(...((((((((((..((((...((((((((....(((((((.................))))))).....))))))))...))))((((((((.........))))))))(((((.(((((((((((((....((((..((.((((((((((.(((.........))))))))....))))))).))))....)))).)))))))))))))))))))))))).).)).)))).)))))))).......)))))))).))))..))))))))((((((((.....))))))))((....))..))))).)))))..)))..((((.(((...)))..)))))))))))..))))...)))))..(((((((((((((((....))))))))))))))).(.((.(.(((((.(((.(((..((((............))))))))))))))).))).).((((..(.(((((((..(((((((((.((((((((((((((((.((((((.(((....))).(((((((.((((...)))).)))))))..(((..((((((((.(((.((....)).))).)).))))))..).)).((((.....))))(((((.(..((((..(((((((.((...............................((((.....))))...(((..((((((.((((..(((.(((...))).)))..)))))))))).....))).((((.(((....))).))))...(((....))).....)).)))))))..))))..)..))))).....((((.....))))...(((((((.((((((((((.((...)).)))))))))))))))))...))))))))))))))).................))))))).)))))))))..)))).))))..)))).....(.((((....)))).).)))))))).((((....((((((((....))))))))..)))).(((((((((.......(((((((((.((((.((.....)).).)))...)))))...)))).))))))))))))))))))))))))).)))(((((.((...((((.(.....).))))...))..)))))......))))))..((((((.((..(((((((...((.((.((((((..((...(((..(.((((.(((...))).))))).)))..)))))))).((((((.((.((...........)).))))))))..))))...))))))))).)))))).))))).)))))...)))......)))))).))))))))))..(((((.........)))))((((((((.........)))))))))))).)))..))).))))))).))))((((........(((((.(....).)).)))........))))........))))))))))))(..(((((.(.((..(((......))).)).).)))))..)))))))))).....(((((........(((((((((((((((((((((...))))))))))).(((((...((((.(((((.((((((((((...((..........))...)))))).))))..)))))..))))....)))))..(((((.....)))))))))))))))((((((((............))))))))(((((((.((((....(((......))).)))).)))))))..))))).....))))))).........))))))))......
Thermodynamic Ensemble Prediction
..,(((.....)))|((((((((((((((.((((((.,..((((.(((((((((...))))))},)).))))...((((.(((((.(((((((.{..((.(((((.........(((((((.((.......))))))))).))))).))..).)))))))))))).)))).))))))(((({((((((((((((((((((((.(((.((((.(((.(((.((((((.((((.((((((.((((((....)))))).))))))..)))),)}...((((({(((((((((((.((.((((({((.(((((((.((((.(((....))).))))))))))),|||((((.(......).)))),|||{...,,}})).))).)).)).)))))))))))...((((((((((((....)))))........)))))))...{{((.,|((((((,,((((((((.(((((((((((....))))............((((({....,(((..(((....)))..)))))))))((((((.((((..(((((((.((((((.((((((((.(((((((..((((((((.(((((...(.((,,((((((((((({((({,{{{{..((((((((,((.{(((({((..({(((((.{.(((,((({(((..((({..,,,{,.{|...|||.||||||},},|}.}})}})})||||}..(((,.,,,,{(((((,...}}}}))),}}))}||.,{{{{{(((((((((((((((((((((.(((((((((((((((,,.....||(((,...}}}.{{{{.....))))..,((.(((((((....))))))).))))))))))))).))).))))).....((((((((.....)))))))){{{{{....{||||,{((((,,.,,{,,.,,}})})))}).||,,,.,,|....}},)))))}}))))))))))}}}}.,,,..((((,,...((..(((((((((.((.(((,,(((.(((((({((((((((((((.(.((((,{((.((,(((.((((.........)))).)))..{{((.......)))}....((((((((.,,(.(((((((.......))))))))).))))))))..,|||||{{{{.,({,{.(((.......)))}.}|,(((((({(((((((((.(,(({{.(((((.....))))).((((((((.(,.((......)),,},}))))))),{,(((((((((((((,((((((((((((((.(((((.(((.((.(((((.,.,{,,({{,,.......}}||,.((((((,{((((((...((((..((((..(((((.((((((((((((((...(((((((((..........)))))))))....(({(((,....}))).,.(((.(((......))).)))......))))).,,}}..})))))))))).))))..)))).((((((({,{{(.{((|{,((((((....((((((({.{({.,,..,})|,,{,{||}}},}|}.{|||,{(((||(((.((((((((((((((.((((...,{,{.((((,,{{,....,,...((((((...}|||}}....|,,|,.,,,{,{{.,{(.(((((..,{{,.|,....})).,..,,{||}||{||....,|||,|}|||,,.((((.(((((.((((.(((..((((((.((((((.({(({,((....})})).}}})..||.}}}},},)).))))))..))).))))))))).},|||||}}..||||}(((((((.{({....{(,.....}}....))).))))))).,,,,,.{{{{{{{{|,,,...}}|}},{|||||}|,}||}}|}}}}}||)),}|||},},.},.)}}},,.,,.},|{,{,,.}}))))))),}))),,.,,.,||,||}}}.,)))))))))).))))}}}))}.((((({(..{.{{{{{,|||{,{,,((..((......))..}}.}|}|,}||||...,.}|||}.}}..)))}}.}}}}})))),}},},},,))))),}}}})).)))))).},}}},})}}},,.,,)))))|||.||.,,,))}},.((((((((.((((,,,,||}}.....{{{{{{{{........)))))))),,))))))))...((((.((((((((.....))))))))))))..))))))))))))).,,)))))))))).))))).))))))))},)))))))))},.,.))))))))..},,....{({....))|(((((((.....{({......}}}..))))))))))))}.)}))))))))}))))))|((((.((((((.((((.....{{.,...||.||,....{{{|,..,...}})}.......)))).)))))).)))))}}).))}}|||}..,|}|||((({{{(,,{,,...}}.))),))))),}.{(((((((......))))))))}).))}))))).))).)))))))}....,,}},.}))))).))))))),)).)).}..)))))),.,}......)))){{,.{((,.((((((..,.,{|||||{|,..,,),}})),))))))))..))),})})}}.))),.))).))))))}).,)))})))}..}))}}},,})))})..(((((((((((......)))))((((....))))))))))(((((((((..........))))))))))}))))))))))}..,,.,..))}}},))))).)))))))).,{(((((((.....)).)))))||((((((((((((((((.....)))|{{((((.(((((.(((((,{,(.{((((,,,,..{{{(((((,,......{(((((...(((((..((.(((.....))).))}))))...}))))}(((((...((((((((................))}}}))))....)))))}}))))))....))))),}))))).))))))))).)))|,|,,,,))),((((((((..{(((..(((..((.{{{(,{,....,}},,}}}...))..)))..)))).)))))))),))))))))))))},)))))))..))))).)))(((....))).))))))...)))))))..))))))))))((((((.{(((.(((((((((({{(((((({,,,.,...||||||{..{{{||||.{{(((((((...|||,..}}}}}),)))}})),))))})|{{{|.||.,,}),,||||||{.},..,,.))))}},..))))))).))).,.))))))))))))).)))))))).}.))))))))))}...,.))))).((((((((.((((((((....(((.((((((((((....((((((..((((((..(((((((((.({(((((((((((((((,..((((((((((((((((((((...))))))).{(((.{(.((..((((((((((((((,{,.,....,{{{{({(((.{({.({.......}}))}.)}}|},}}}}((((,.{..,,,,...........,,}}}.(((({..{{{..(((((({,((,,,.|||...((((((...))))))..((((,.,....)})),,,.(((((((((........))))))))).))})})}..))).....)))))..{(((......)))}.................{(...,..))...((.((((({...)))))).))...})))))))))))))...))))))||((((......))))}|({((((((......)))))).),)))))))))))))..,,,..(((((((((((({...})))))))))))).|((((....))))}((((....))))..,,(((.(((((((,....(((((.(((((.((((..(((({....})))).........)))))))))..))))).(((...((..((.(((....))).))..))...))))))).))).)))..,}.)))))))))))}.})))})),.,)),,))}})),,))}}}|,.{{.(((.{,({{((((((((((((((((((((..((({.,.,(((.(({(((,.(({{((({(((({(((((({(,..(({..(({((((.....((((({..,,,(((((((....)).))))},,||||(((((((,.......{|||,|,{|||||...||||...||}},.....||||{{{{{|.,,,.}})))))))}((((((((((((((.(.(((.(((((((....(((((((((.............)))))).)))....))))))).))).)))))))))))))))......,..})))))).}})))))}.,},.))))))))))....)))))))).,},.|||||{||||{|{{{{((.((((((((.,....,}.}})))))).)}...{{{{((((({|{|,,{|||,}|,,|,,}}|||(((({,(((((((,({((({(((,{{{,{{{{....,,,{{,...((((((((...((((.,,.,...(((((((((({{(,(({,.,{((((((....(((((((.................))))))).....))))))))}}.))))..,,,,,,{{((({{{.||((({,,..{{..,,,,..||,||,.}}}}|,,,...{{(((,((,{((,(({.....,}}}))),))))}.}}))))))...,,......,||{|||,,,)))))}..,))))))))).}.},.)))).))))))))...,,||}))|}}}}|}},|,,)))|||||||||{,{{.,,},)))))|||||.|}}|)},),}.}|))}},.,))}},((((.{((...}})..)))))))))))..}})),..))))),|((((((((({(((((....)))))})))))))))},|{|{|{|||{,,|||.{(,{{(.(({.,,|,|....,))).)}))),)))}}.,,....{{||}}|}||(((((..(((((((((.((((((((((((((((.((((((.(((....))).(((((((.((((...)))).)))))))..(((..((((((((.(((.((....)).))).)),})))))..).)).((((.....))))(((((.(..((((..(((((((,((,,,.....,,,......,,,...,,...,|.((((.....)))),..(({..((((((.((((..(((.(((...))).)))..)))))))))).....))).((((.(((....))).)))).,,(({..},))}.,},.)).)))))))..))))..)..))))).....((((.....))))...(((((((.((((((((((.((...)).)))))))))))))))))...)))))))))))))))........,,{....}}))))))).)))))))))..))}),))}},.})))},},.|}||,|}},.,,})})))))))))).((((....((((((((....))))))))..)))).(((((((((.......,(((((((({((({.((.....)).},})).},)))))..,)),,.))))))))))))))))))))))))),))).||||{(((((((((((.........))})...}))))})),....))))))..((((((.((..(((((((...((.(({((((((..((...(((..{.((((.(((...))).))))).))).,}})))))).((((((.((,({........}..)).)))))))),.))))...))))))))).)))))).))))).)))))...)))......)))))).))))))))))..(((((.........)))))((((((((.........)))))))))))),))}..))).))))))).))))((((..{,.,..(((((.{....}.)).)))..,.},..))))........)))))))))))){..(((((.,.((..{{{......}||,||,}.}}}||,,||}}}}}})),,,,,|||||}|,,,,,,{,,,(((((((((((((((((...)))))))))}}..,{{{.{,{{{{||||...{|{{{{{{{{,...,...||,,,|,}},,.,}}))||{|||{,..,,)..))))}}..,,},|,.||{{|,,...}))))))})},,}))||{||||{,........,..))))}|||(((((((.((((....(((......))).)))).)))))))}))))}},,...))))))).........))))))),......

Transcripts

ID Sequence Length GC content
CUUUCGGAAAGCGAGGGAACAGUGCGCGCAGCGCUCCGCCCAGCUCCGU… 6419 nt 0.5819
Summary

The protein encoded by this gene is a member of the SLC6 family of transporters, which are responsible for the presynaptic uptake of most neurotransmitters. The encoded vesicular transporter is selective for proline, glycine, leucine and alanine. In mouse, the strongest expression of this gene was in cortical and hippocampal tissues where expression increased during embryonic brain development and peaked postnatally. Defects in this gene cause a form of autosomal recessive intellectual disability. [provided by RefSeq, Jul 2017]

Forensic Context

A study in rhesus macaques identified the SLC6A17 as a shared upregulated differentially expressed gene in left ventricular tissue from animals with hypertrophic cardiomyopathy compared to pediatric human cases [Rivas et al. DOI:10.1038/s41598-024-82770-4].