| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUCGGAAAGCGAGGGAACAGUGCGCGCAGCGCUCCGCCCAGCUCCGU… | 6419 nt | 0.5819 |
The protein encoded by this gene is a member of the SLC6 family of transporters, which are responsible for the presynaptic uptake of most neurotransmitters. The encoded vesicular transporter is selective for proline, glycine, leucine and alanine. In mouse, the strongest expression of this gene was in cortical and hippocampal tissues where expression increased during embryonic brain development and peaked postnatally. Defects in this gene cause a form of autosomal recessive intellectual disability. [provided by RefSeq, Jul 2017]
A study in rhesus macaques identified the SLC6A17 as a shared upregulated differentially expressed gene in left ventricular tissue from animals with hypertrophic cardiomyopathy compared to pediatric human cases [Rivas et al. DOI:10.1038/s41598-024-82770-4].