Basic Information

Symbol
SLC6A19
RNA class
mRNA
Alias
Solute Carrier Family 6 Member 19 B0AT1 Sodium-Dependent Neutral Amino Acid Transporter B(0)AT1 Solute Carrier Family 6 (Neutral Amino Acid Transporter), Member 19 System B(0) Neutral Amino Acid Transporter AT1 Broad Neutral Amino Acid Transporter 1 Solute Carrier Family 6 (Neurotransmitter Transporter), Member 19 Sodium-Dependent Amino Acid Transporter System B0 System B0 Neutral Amino Acid Transporter Hartnup Disease HND
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_001003841.3
Sequence length
5168.0 nt
GC content
0.5658

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2136.70 kcal/mol
Thermodynamic ensemble
Free energy: -2220.64 kcal/mol
Frequency: 0.0000
Diversity: 1527.80
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((...(((.((((((((((.((((.(.((((((((.(((((.(((((.((.((((((.(..(((((((((...((.(((......))).)).....(((((((((((((((((...((.((......))))...)))))))..)))))....))))).....)).)))))))..)))))))((((.((((((......)))))).))))....(((((.((..(.(.....).)..)).)))))(((.(((((((............))))))).))))).)))))))))).))).)))(((((......((((..((((....(((((((..(((.(((((((((.(((.(((((.((((....)))).))))))))...(((((((...(((.(((...))).)))...)))))))(((((((...(((...)))...))))))).(((((((.....(((.......)))......)))))))))).)))))..).)))..))))))).....))))..)))).)))))...(((((.((((((((((((((((((((...((((((....)))).))((..((((.............))))..))...((((((((((((.(((....(((((((((.(((((((((((((.(((.(((((.((..((((((((.((....(((.(((...........))))))..))))))))))..))))))).)).((((...(((.....)))......((((....))))(((((((((((((((.((((....)))).........))))))).)).....)))).)).(((.((((((((((....))))))))..)).))).((((((((((((..((((((((((((.......((((((.....(((((((((((.((((....))))........))).))))))))...((((((.......))))))...))))))((((((((((..((((((.(((((((((.(((.(((.((((((((((((((((.(((((......)).)))(((((((((((((....(((......)))....)))))...)).)))))).....(((((((((((((......((((...(((.((((.((((...(((..((....)).)))....)))).)))).)))))))(((((((.(((((.((((.....((.((((((..(.(((((((.(((..((((((((((.(((.......(((((((........(((....((((((((.((.((((((((..((((......((((((((((((..(((((((((.((((((((....)))))))).)))).......))))).))))).....)))).)))......)))).(((((.....)).))))))))))).))......)))))))).....))))))))))......))).))))....))))))..))))))))))).(((((.((....)))))))..............((((.((((.....)))))))).)))))).)).....))))..))))).).))))))......((((.....))))......(((.....))).....))))))))...))))))))))))(((((((((..((((.....(((((((.(((.((.............)).)))))))))))))).))))))).))......(((..((((((((...((((.((((..........))))...))))((((.....))))...(.(((((((((((((.((((..((((....)))).)))).)))(((((....((.........))...))))).)))))))))).)))))))))..)))((((((((((.((.(((...))).))))))).)).)))...))))))))).).)).))).)))))......)))).).)))))))))))))))))))).)))))))...)).))))))))))))))).)))))))))((((((((((((.(((((.((....)).))))).)))))((((.((((.(((..(.(((.((((((((.....(((((.(((((...))))).)))))))))))))..(((((.(((((....(((.((((((((((((((((((((((((((((((((((((((.((((((((((((((((((((.((((((((((..(((..(((((((((((((((((((...((.(((((.....))))).)).))))))))))))))))))).)))..)))))))).)).))))...))))))))))))))))..))))))))))))...((((((.....))))))......(((((((((((((((((((((((.(((((((((((((((.....((((((((.((((((((((((((((((.((((.....((((((((((((((....))))))))))))))...((((((((........)))))))).)))).))))))))))))))))..)).)))).))))..)))))....)))))))))).)))))))))))))))))).))))).((((((((((((((((..(((..((.(((((((((((.(((((((.((((((((((((((((.((.((.((((((((....)))))))).)).))...)))))))))))))))).)))))))..))))))))))).))))))))))))))))))))).))))))))..)))))))))))))))))))))....))))))))))..(((..(((((......)))))..)))..))))..))))))).)))).))))))).((((((((.((((..((((.(((((.((((((........)))))).))))).(((((((((.((.(.(((((((((((((((.(((((((((.(((.(((((...(((((((((((((.(((..(((((((((.((....(((....(((((((((...))))).))))...)))...((((((........(((....)))........))))))....)).))))))).)).......((((((....))).)))((((((((((((.(((.....((((.....((((...((((((.((..((((.(((((...))).)).)).))..)).))))))))))..))))))).)))))..)))))))..((((((.....))))))....)))))))))))))).))...))))))))((((......))))...(((((......)))))..............((((.((((((..(((((.(.((.((((..........))))))))))))))))))(((((....((((((......))))))....)))))(((((((((.....)))))))))))))..))))))....))).))))))).....)))))))).).))..(((...)))...(((((((.(((((((...((((.((((...)))).((((((((....))))))))..........))))....)))).))))))...))))...))))))))).......))))..)))).))))))))((((...((.(((((((...........))))))).))...))))(((((((((((((.........(((.((((((.....(((((.............((.(((((.(((.......((..(((((....(((.((......)).))))))))..))...((((((...))))))))).))))).))..(((((..........))))).((((.(((((.....(((.......))).....)))))))))..))))))))))))))(((((((((......(((((((....((.((((((..((((((((((....((((((((..((((((((((((.(((.................((((((..(((((((((...((((((((((.........))))))))))...)).(((......)))(((((((((((...(((((((......((........))......)))))))....))).......)))))))).)))))))....))))))(((((((((..((((((((..((...((((((.((((.((((.((((((((((((((((((.......)))).)))))))))))))))))))))).).)))))))..))))).)))..))))))))).))).))))(((....)))..((((.((.((((((.....((.((((((....((..(((......................((((((((.(.(((((((....))))))).).)))))))).........((((((.((((....))))...))))))..)))..))....)))))))))))))))))))))))))))).)))).))))..((.(((((.((((((.......))))))))))))))))))).)))).(((((((.....)))))))(((((((((((....))).)))))))).....)))))))).....................((((((.(((......................(((((((.(((.((((....((((....))))..)))).)))...)))))))..(((....)))))))))))))))))))......))).)))))).......(((((....))))).))))))))))))))))).)))))))))..))))))))))..)))))(((......))).)))))))))))..(((.....)))....)))))..))))........)))))....((((((((((((.....))))...(((((.......)))))((.(((((.....))))).))......)))))))).))))))))))...))))))).)))))).))))).(((.(((((((..((((....((((..((.....)).))))))))..)))))....)).)))..((.((.((((((((((((((((((.......))))..)))))...........))).)))))).)).))............................
Thermodynamic Ensemble Prediction
.{(((({({{({(({.(((((((({(.(({(.{.({((((((.(((((.(((((.({.(((((({{..(((((((((...{(,(((......))),)).....(((((((((((((((((...((.((.....,)}))...)))))))..)))))....))))).....)).)))))))..}))))))((((.((((({......}))))).))))....(((((.({.,,,{.....|,|..}}.)))))(((.(((((((............))))))).)))}).)))))))))).))).))){{{(({({{,.((((.,((((....{{|||{{,,(((,(((((((((.(((.(((((.((((....)))).))))))))..,(((((((...(((.(((...))).)))...)))))))|((((((...(((...})}...)))))),,(((((((....(({(.......,),,)....))))))))|}.}|))}|,|,|||,.}}}}})),,,..}}}}..})}).)))))},.{{|{{.((((((((((((((((((((.{((((({,{,..,||},..({({{,.,,,...,.}}}}...)))}},,,,.((((((((((((.(((....(((((((((.((({(((((({{(((((.(((((.((..((((((((.((.,..(((.(((...........)))))).}))))))))))..))))))).)).(((({..{.(({{..|.,......{(((....))))},.)))),,,.}))))((({....})))...{{,...{{||,.{{(,,,..}}}...))}},,}}}{(((((((....)))))))){{|.{|||,((((((((((((..(((((((((((((({,...{||||{,,,,,(((((((((((.,{{,....}}}}........))).))))))))...|||||,.{.,..,,})}}}...))},,,(((((((((({,{(((((.(((((((((.(((.(((.(((((((((((((,,,.,,|||}.....}|.}||(((((((((((({..,.{((......}}}..}})))))...))}})))))||.,{(((((((((((((...,(({((,,.,{{,((((.((((({{{(((,,,{.,,{{({(({,,..|(((((((((....))))..))))).,....,,{{,,,.......})))}}))|(((((({((({{((((((((,..,{,.......|}|||||.......||{{....,|||,,,,,,|.||}|||||}}|}||........(({{{,,,||..|||||{{{{.((((((({....}))))))),)))).,}}}}}))),)}))}||{{{.{{|||.|||,.....(({({((,({{{.(((({{(((.(((((.......)))))))).))..)))).})))}}}),.}}}}.,|,|||,....||||,|{,.|||||,|||..|,,||},|}}}})))})))}.....,....},.{{{{.((((.....))))))))..))))).))))}.,|||..((((((((((.{((((.....}))}.,,..)))))).)))),{}}}..},}},,..))))))))...)))))))}))||(((((((((..((((.....(((((((.(((.((.,.........}.)).)))))))))))))).))))))).}).,,...(((..((((((((..,{(({.,{{,..........}}}},,.},,{((((,...,))))}..{.(((((((((((((,((((,,((((....)))).}}}}.}}}{{((({...||,,......}))..,,)))}.)))))))))).}))))))))..)))((((((((({,{(,{{{...,)),))))))).)}.)))...))))))))).).)).))).))))}.....,)))).).))))))))))))))))))))}}))))))...)).))))))))))|||||{|,|{{|{||{({{...((((((((.{.((((...(((((((({(({((((..((((((((({,{{|||||||,((({{((((,,,,,.|||||}}}.}})}})))),})}))))))),,|||}...,|}}}}||||||((((((((((((((((((((({{{((((((((((((.{(((((((((((((((((((.({((((((((..(((..{((((((((((((((((((...((.(((((.....))))).)).))))))))))))))))))}.)))..)))))))).)).)))),}.)))))))))))))))},,)))))}))))))..,||||||,,,,}))))))||||..(((((((((((((((((((({((,(((((((({(((({{,{{.,((((((((.((((((((((((((((((.((((...,.((((((((((((((....)))))))))))))).},((((((((........)))))))).)))).)))))))))))))))}.,)).)))).)))),.)))}}.,}})))))))))),})))))))))))))))))},))}}.{(((((((((((((((..(({.{((.(((((((((((.(((((((.((((((((((((((((.((.((.((((((((....)))))))).)).))...)))))))))))))))).))))))).,})))))))))).))))))))))))))))))))).))))))))}.})))))))))))))))..)))).}.)))))))).}}|{.,,,|{|||,,.(((.(((((((((..((({{{{{.........))))).))).,|)))))))).))).,.((.(((((.((((((........)))))).)))))}||..((((.(((((.((((....(((((((.(((({(({{{(({{(((((.(((((((((((((((.(((.,{{.((((((...|}}}}||||..(((((((({...})))).}}}|,,{{{{,,,,,,,,{..,,....(({,...,,|..,,...,)))))|{|||||||}}||)|,))}}}....,{||{|,,,.))).,))||{{{||{||||,{((..{{,((({.,,,.((({..,((((((.((..((((.(((((...))).)).)).))..)).)))))))))).,}}|,}}|,|||},..,))))),..{|||||,,,,,}))),,....))))))))))))))}))...))))))))|(((......})),...(((({......})))),.........,,,,(({(.((((((..{((((.(.((.((((.,........)))))))))))))))))}(((((....((((((......))))))....)))))(((((((((.....)))))))))))}}..}))))}...}))).)))))))..))))..))))).))))..{{{...)))..}|||||}}}|}|,}||}}}||||}|,||},.,|||{((((((((....)))))))}...}}}}...))))}}..})))}},}|||,..||}}.},,,)))),||{{{{{{{||||,.||||{|,,,}}})||{({.,(({((((,((..(({{{{{,.((((,|(({,..{{||,.}||||)}||.}})).,,}.}}}}.}}|,{|}.,}}}||||,}}..,,,,...,|{({||{{{,{{{.,,.,.,{(|,(((((,...{{{{{,.,,,.,}},,},,))})|,}),..((((({...})))))}}}.))}}}.,},,((|{({{{.,.....))))),|,||||||||,.|,,|||.......}|},....)))},}}||,..{{{{||||||(|(((((,{{(({{.({{,,,({,(,||.,({((((((..(((((((((,.{{.((((((((..(((((((((((({(((....,{.,{{..{{{{{((((((..(((((((((...((((((((((.........)))))))))),,.}}.{((,,,...}}}(((((((((((...(((((((......{{........}}......)))))))....))).......)))))))).))))))}....)))))),,|||||,,}}}|||||||.|}}},,((((((.(((({((((.((((((((((((((((((,....,.)))).))))))))))))))))}}}}},.}.,})))))}))))))})},{{||||,|||,..,)}))))}}}.(((({((((((.(((((,(({,.,{{,.{,.{((({|..,|,..,|...}}}}}},,..,..,.,{{|,((((((((.(.(((((((....))))))).).)))))))).........((((((.((((....))))...))))))..,|,,,,}...))),))))))))))).).))))})))))).)))).)))).}}|.(((((.((((((.......)))))))))))),)))))).)))).,,,))))))}}{|||||||(((((((((((....))).))))))))....,|||||...........,,,,........,|||{,{..,....,,,...,.......}}....(((({,.(((.((((.,..((((....)))).,)))).))),,,)))))))}}|||,,..)))}))))))))))))}}},,...,))))},))))}...,),(((((....))))}.))))))))))))))))).)))))))))..))))))))))..)))))({{......))}.)))))))))))..(((.....)))....))))},.}))).....,,,|||||,,,,((((((((((((.....)))).{{(((((.......))))){|,(((((.....))))).}}......)))))))),}}|}}}}}}}...})))))).}))))),)})))}|{{,{{{{{{|,,(({{....||||,,|{..,,,||,|}}})))).,))))),,,,)),)))..||.({.((((((((({((((({((,..,,.,|}}}},,))}},,.........))),}))))).}}.)}............................

Transcripts

ID Sequence Length GC content
ACUCGCCCUCCAGCUUCUGCCCUGCCUGCUGUGUGCGGAGCCGUCCAGC… 5168 nt 0.5658
Summary

This gene encodes a system B(0) transmembrane protein that actively transports most neutral amino acids across the apical membrane of epithelial cells. Mutations in this gene may result in Hartnup disorder, an inherited disease with symptoms such as pellagra, cerebellar ataxia, and psychosis. The expression and function of B0AT1 (SLC6A19) in intestinal cells depends on the presence of the accessory protein angiotensin-converting enzyme 2 (ACE2) which, among other functions, acts as a chaperone for membrane trafficking of B0AT1. The ACE2 is also the cellular receptor for severe acute respiratory syndrome-coronavirus (SARS-CoV) and for SARS-CoV-2 that is causing the coronavirus 2019 (COVID-19) pandemic [provided by RefSeq, Jul 2020]

Forensic Context

No relevant information is available at the moment.