Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGACCGCCCAGCGCUGCGGAGCGGGAGGGGAGGCUUCGCGGAACGCUC… | 3942 nt | 0.5852 |
Summary
This gene encodes a dopamine transporter which is a member of the sodium- and chloride-dependent neurotransmitter transporter family. The 3' UTR of this gene contains a 40 bp tandem repeat, referred to as a variable number tandem repeat or VNTR, which can be present in 3 to 11 copies. Variation in the number of repeats is associated with idiopathic epilepsy, attention-deficit hyperactivity disorder, dependence on alcohol and cocaine, susceptibility to Parkinson disease and protection against nicotine dependence.[provided by RefSeq, Nov 2009]
Forensic Context
A study in mice demonstrated that prenatal exposure to psychostimulants like amphetamine, cocaine, and methamphetamine permanently impairs pancreatic beta cell insulin production and leads to glucose intolerance in adult female offspring, linking this effect to disrupted serotonin signaling and sex-specific epigenetic reprogramming [Korchynska et al. DOI:10.15252/embj.2018100882]. A study in mice demonstrated that the SLC6A3 (Slc6a3) exhibited high expression in the ventral midbrain but was not detected in the prefrontal cortex or nucleus accumbens of experimentally naïve mice selectively bred for high or low methamphetamine consumption [Hitzemann et al. DOI:10.3390/brainsci9070155].