Basic Information

Symbol
SLC6A3
RNA class
mRNA
Alias
Solute Carrier Family 6 Member 3 DAT Sodium-Dependent Dopamine Transporter DAT1 Solute Carrier Family 6 (Neurotransmitter Transporter, Dopamine), Member 3 Solute Carrier Family 6 (Neurotransmitter Transporter), Member 3 Dopamine Transporter 1 DA Transporter Dopamine Transporter PKDYS1 PKDYS
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_001044.5
Sequence length
3942.0 nt
GC content
0.5852

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1546.00 kcal/mol
Thermodynamic ensemble
Free energy: -1614.91 kcal/mol
Frequency: 0.0000
Diversity: 1159.15
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((..((((.(.((((.((((.((((((((((((.(((.(((....)))))).))).........(((((..(((((((((((((.((((((.(((.((((((((..(((..............((((((((((.((((((...((((((..(((((((((((.(((....(((((.(.(.(((((((((...((...))...)))).)))))).).)))))..)))))))).........))))))....((.(((.((((....)))).)))))........(((((((((((((..((((.((((((((.((....))))))))((((((((......)))))..))))).)))).))))))))))))).....((((.....))))(((......)))..............(((((.((.(((.....))).))))))))))))))))))).)).)))))))))))..))))))).).)))..)))))))))))............(((((((((((((((((...(((.((((((.((((((((....))))))))...)).)))).)))......)))))...).)))))))))))..............))))))))..)))))..))))))))))))).((.((((((((.((.((.((((.....(((.....(((..((.(((......))).))))))))..)))).)).)))))).)))).)))))).))))).((((((((((.....((((.(((((((.(((((.((.......)).)))))((((((((........((((((((((((......(((((((....((((((((((((.(.(((.....)))).))).)))))))))........(((((((((......)))).))))).)))))))...((((((.((.....)))))))))))))))..((.((((((...(((((((...(((((((((((((.((((.(((.(((......))).((((.((........)).))))........(((((((((..((((((((((((((.((((((.((.((((((.(.......))))))).((((((...((((((.(((((((..((((.(((......................)))...)))).))))))).)))).))..............((((((((........))).)))))((((((....(((((((((((((((((((.........))))))(((((((((((((((....((..(((..(((..(((.......)))..)))....))).)))))))).)))).(((....)))..((((((((((((.....(.((((((((((((.((((........))).)...)))))))))))).).....))))))..)))))).))))).(((((((..(((.(((.......)))))).......(((((.(((((((((((.......((((((((((((((..(((((.......(((((............(((((((((((((((.(((.((((.(((((.((((.......)))))))))((((((.....)))..)))((((((((((.((((((((.((......))..))))).)))..)))..))))))).((((((..(((......))))))))))))).))).)))))...((((((...(((((((....((((..(((((......)))))....))))..........((((........))))......(((((...((.(((((((((.(((.(.((.(((((((((..(((((((...))))...((((((((.....((((((..(((((((.((((((((((.(.(....((((....))))...).).)))).)))))).(((((((((((.(.(((.((((.((...)).))).).))).))))))))))))))))....)))..))))))..((.(((........))).))((((..((((((..................(((((....)))))(((((...(((((....))))).))))).........((((.((((((........(((((((((......))))))).)).......((((...(.(((((((((((((......)))).......(((.(..(((((((((..(((((........))))).....)))))))))..).)))((((((............((((((((.....))))))))............))))))...))))))))).).)))).(((((...))))).)))))).))))((((((((.....((...((((......))))...))))))))))(((......)))(((((...(((((((((((...((((.....(((((((((.....)))))))))...))))...)))))).)))))))))).........(((((((..(........)..)))))))))))))))))))))))))((((((....))))))((((.((((......)))).))))....)))..))))))))))).)(((((((.......)))))))...(((((...(((....))))))))(((........)))..)))..)))))))))))..(((((.....)))))((((((((.(((((((((((.(((........((.((((.....)))).)))))..)))).)))))))..)))))))).((((((((.......))))))..))..)))))..)))))))...((((.......))))....))))))......))))))))))..))))).....))))).)))))).....))))))).).........)))))))).))).))))).....)))))))))))...))))))))).....).))))))))))).))..))))))..))))..))).))))))).))))))))).)))..)))).)))....)))))...))))).))))))).((....))...((((.((.((((((((((((((..((((((((...)).((((((.((......))..)))))).)))))).))))))(((((((.(((((......)))))..)))...((((....((((((((....(((.(((((...(((....((((.(((((.(((..((((..((...((((..........))))...)).))))............(((((...(((((((.(((((...........(((((((((.(((((....))))).)))))))))))))).))))))).)))))....)))...))))).))))...)))(((((...((((((((.((((((...((((((((....((((((..((..((((((..((.....)).))))))...))..))))))((((..((......)).))))))))))))..)))))).)))).))))..)))))((((.((...)).))))))))).))).....)))))).))...))))((.((((((((((...(((((((((((.((....))))))))..)))))..))))))))))))..)))))))))))).)).)))).)))))).)).......((((.(((((((.(((((((.((((.(((((.((((((((((((........))))))))......((((....))))....)))).))))))))))))))))..)).))))).))))((((((((........))))))))))))).))))))))...))))))).))))))))).)))))....)))).......(((..(((((((..((............))..))))))))))......
Thermodynamic Ensemble Prediction
{(((..((((,(,((((.(({(.((((((((((((,{{({{(,.,,,|,}}})})}}.,,,...,,(((((..((((((((((((({(((({(.(,,.{(((((((..(({........,,,...((((((((((.((((((...((((((..{((((((((((.(((....(((((.,.(.(((((((((...((...))...)))).)))))).,.)))))..)))))))).........)))))}....((.(((.((((....)))).)))))........(((((((((((((..((((.({((((((.((....)))))))){|,,({{({......,)))..})))).)))).))))))))))))).....((((.....))))(((......))),,,...,,......(((((.((.(((.....))).))))))))))))))))))).))},))))))),||,.|||||||...,,|{{||||||,,,))}}}}}}}....}}||||||||{{||((((...(((.((((((.((((((((....))))))))...)).)))).))).,,,..}}}}}..,}.}}))))))))).....},,......))))))))..)))))..,}}))))))))))},|.{{{{(({(|({,{({((((,{{{,({{.....{((.{({.{{(,.,,..}}}.}|}}||}}..}))).)),},}}}),)}))|}.)})}.,)))).((((((((((.....((((.(((((((.,((((.((.......)).))))}{(((((((,,{{,{,,((({,,,{(((,{,{.,,(({{({(({{{{((({{{(({({.,.{{{||,|,}}}||}}||}}},}}}}|||{||,,,,{{({(,{,|||||(((((((((.((((.,.((.(.((((((.((.....)))))))).).))....}.)))).)))).)))))((,{{,|,(((((((,.((((.(((((((,,....((({(.((((.((......,.|}.}}}},,,,....(((((((({..((((((({{{(({{.((((((.((.((((((.{.......,)))))).((((((,,.((((((.(((((((.,((({.(((........,,............)))...)))).))))))}.)))).)).,........,,.,((((((((........)))},))))|,,,.,..,.((((((((((,,,((((((.........))))))|...(((((((((((...{(.,.{{({.(((..(((.......)))..))))}..})).,.)))))).))))|((((...((({{((({((((((((..,,.(.(((((({{{,(({(({{(({.......),})),,))))))))))).)...,.)))))},))(((({....)))))}))))}}),,).))))}....{{({{,..,}}}}(((((.(((((((((((.{,,...{(((((((((((((..((((({......(({((,......,,...(((((((((((((((.(((.((((.(((((.((((.......))))))))){.{(({.....})),.}}}((((((((((.((((((((.((......))..))))).)))..))}..))))))).((((((..(((......))))))))))))).))).))))).(,((((((...(((((((..{.((((..(((((......)))))....)))),.,{,.....||.({{{,..,,...,..},.,)))|....((.(((((((((.(((.(.((.(((((((((..((({(((...)))}...((((((((.....,(((((,.((((({,.((((((((((.{.,.,{.((((....)))),}.,.},)))}}}))))).(((((((((((.(.(((.((((.((...)).))).).))).))))))))))))))))}}}}}||{,||||}|,,,,.{{{..,,{{,.|}}.}}||((,.{(((((,{{{.,,..........,({{{{....))))){((((...(((((....))))).))))),....,,..((({.{((({{...{{{..,{(((((((......))))))).})}}}....({{{...|.{{(((({(((.(((((((.({((((,{(((((......|}})}})}.)))}....}}.))))))).,.,..}},}}}|||,,,.||||{||{{......,.,...((((((((.....))))))))........,,},)))),,..,))))))))).,.}))),{(({{...))))|,}}})}}.})))((((((((.....{{.,,{{{{......)))),)})}))))))))|||,...,,})){((((...(((((((((((...((((,,...{((((((((.....))))))))),}.))))...))))))))})))))))}..........{{{{{,..|},,,,,,,),.)))))))))})),))}))))))))){(((((....)))))}((((.((((......)))).)))),...)))..))))))))))).)(((((((.......)))))))...(((((,..{((....))))))))(((........)))..)))..)))))))))))..(((((.....)))))((((((((.(((((((((((.((({{{{,{{{,..,}},,}}},}}}..))))...)))).}))))))..)))))))).{{((((((.......))))))..)).{|||||{,,,})),|{{(((((.......))))}.,})),))))}}..,))))))}|||,.||,,,..,}.))))}.)))))).....})))))),),}.....,.}})))))).))),})))|,,...}})}}}|||}}..}}}})))))).},.,},}))))))}}}).))..))))))..}}}},,))),,)))))).}))))))))...,,))))),|{|{.,,.,.,,})}}))}}}}||||||{,,...|||||,{{{{.,|.|,,||||.{(({(({,(((((({{...}}.((((((.,,......)}..)))))).)))))).},)))),}}}{||}|,{|{..}}.})))))..)))}}))})))))...))))))).})))})))))).|||,......|||.({(((,{{{..((((,,({...{((,.,,,,....,))}}.,,,,.}})).........,{{{{......|||||,,..,,,,..,..|,,,..(((((((((.(((((....))))).)))))))))|||||||,,,.}},)}}}.....))}...))))).)))|||}},}|(({{...{{{{{{{{.((((((.{.((((((((..,{((((((..({..((((((..((.....)).))))))...))..))))))|(((..((......)).)))})))))))),,)))))),))})}}))}..}))))||||,||}}..),)))}}})))})))))),.}}})}}}}}.,,))}}{{,((((((((((...(((((((((({,((....))))))))..)))))..)))))))|||||{.,}},,,,}))))|||..,.,.|.,|,,,|)}))))}.{(((.{((((((.(((((((.((((.(((((.((({((((((((........))))))))......(,((....}}))),,.}))).)))))))))))))))}..)).))))).))),((((((((........)))))))))))}),)))))))}...))))))).))))))))).))))}....,}}}...,,.,|,,,,(((((((..{{............})..))))))},))}.....

Transcripts

ID Sequence Length GC content
GAGACCGCCCAGCGCUGCGGAGCGGGAGGGGAGGCUUCGCGGAACGCUC… 3942 nt 0.5852
Summary

This gene encodes a dopamine transporter which is a member of the sodium- and chloride-dependent neurotransmitter transporter family. The 3' UTR of this gene contains a 40 bp tandem repeat, referred to as a variable number tandem repeat or VNTR, which can be present in 3 to 11 copies. Variation in the number of repeats is associated with idiopathic epilepsy, attention-deficit hyperactivity disorder, dependence on alcohol and cocaine, susceptibility to Parkinson disease and protection against nicotine dependence.[provided by RefSeq, Nov 2009]

Forensic Context

A study in mice demonstrated that prenatal exposure to psychostimulants like amphetamine, cocaine, and methamphetamine permanently impairs pancreatic beta cell insulin production and leads to glucose intolerance in adult female offspring, linking this effect to disrupted serotonin signaling and sex-specific epigenetic reprogramming [Korchynska et al. DOI:10.15252/embj.2018100882]. A study in mice demonstrated that the SLC6A3 (Slc6a3) exhibited high expression in the ventral midbrain but was not detected in the prefrontal cortex or nucleus accumbens of experimentally naïve mice selectively bred for high or low methamphetamine consumption [Hitzemann et al. DOI:10.3390/brainsci9070155].