Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGCCAGCGCCGCCGGGUGCCUCGAGGGCGCGAGGCCAGCCCGCCUGC… | 6335 nt | 0.4436 |
Summary
This gene encodes an integral membrane protein that transports the neurotransmitter serotonin from synaptic spaces into presynaptic neurons. The encoded protein terminates the action of serotonin and recycles it in a sodium-dependent manner. This protein is a target of psychomotor stimulants, such as amphetamines and cocaine, and is a member of the sodium:neurotransmitter symporter family. A repeat length polymorphism in the promoter of this gene has been shown to affect the rate of serotonin uptake. There have been conflicting results in the literature about the possible effect, if any, that this polymorphism may play in behavior and depression. [provided by RefSeq, May 2019]
Forensic Context
A study in mice demonstrated that prenatal exposure to psychostimulants permanently impairs pancreatic beta cell insulin production and glucose homeostasis, specifically linking this effect to serotonin signaling and the SLC6A4 [Korchynska et al. DOI:10.15252/embj.2018100882]. An imaging study in human monozygotic twins found that within-pair differences in acquired obesity, particularly in women, were associated with higher brain SLC6A4 binding in the hypothalamus/thalamus [Koskela et al. DOI:10.1016/j.physbeh.2007.11.043]. Another human study found the A allele of the TPH1 A218C polymorphism was significantly more frequent in suicide attempters than in controls, with sex-specific analyses showing among males, the CC genotype and C allele were more frequent in controls [Beden et al. DOI:10.1016/J.Legalmed.2016.05.005].