| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCACUGCUGAUGAAACCUGGCGCCGGAACCCGCCAGCCCUCGGCGCCCA… | 7343 nt | 0.5274 |
Enables L-arginine transmembrane transporter activity; L-histidine transmembrane transporter activity; and L-lysine transmembrane transporter activity. Involved in carboxylic acid transport. Located in apical plasma membrane and basolateral plasma membrane. Part of protein-containing complex. [provided by Alliance of Genome Resources, Jul 2025]
A study in rats demonstrated that the SLC7A1 was identified as an orthologous gene associated with inflammatory processes in a single-cell transcriptomic analysis of radiation-induced lung injury [Shi et al. DOI:10.17305/bb.2024.10357]. In rhesus macaques, transcriptomic profiling of hypertrophic cardiomyopathy identified the SLC7A1 as a shared upregulated differentially expressed gene between affected macaques and pediatric human HCM cases [Rivas et al. DOI:10.1038/s41598-024-82770-4].