Basic Information

Symbol
SLC7A1
RNA class
mRNA
Alias
Solute Carrier Family 7 Member 1 CAT-1 REC1L HCAT1 ATRC1 ERR Solute Carrier Family 7 (Cationic Amino Acid Transporter, Y+ System), Member 1 High Affinity Cationic Amino Acid Transporter 1 Ecotropic Retroviral Leukemia Receptor Homolog System Y+ Basic Amino Acid Transporter Ecotropic Retrovirus Receptor Homolog Amino Acid Transporter, Cationic 1 Ecotropic Retroviral Receptor CAT1
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_003045.5
Sequence length
7343.0 nt
GC content
0.5274

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2680.40 kcal/mol
Thermodynamic ensemble
Free energy: -2812.31 kcal/mol
Frequency: 0.0000
Diversity: 1944.71
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((..(((.((((((....((((((((.............))))))))..)))).)).)))..(((((((((((((((((((.(........(((.((((.(..((((((((((((.....(((......))).............)))))).))))))..).))))..))).(((..((.(((((...))))).)).)))...(((((.((......).).))))).))))).)))))))))..))))))((((((.(((((((..((((((.((((.((..........(((.((......)).))).........)).)))).))))))..(((....)))..))))))).))))))..((((....((((...((..((((((...((((.(((..((((((((((....)))))))..)))..)))(((((.((((((((((((((((((((((((.(((((((.....)))).((((((.((((.(((.((...((((.((.((((((((.(((...((((((((((((((((..((.(((.((((.(((((((((((((((((((((((((..((((..((.(((........))).)).((((((....)))))))))).))))))).......(((((.....)))))..(((((..((.(((.((.(((((......(((((.((((...(.(((...(((((((((((((......((..(((......)))...)).........(.(((.......))).)))))))))))))).))).)...))))))))).))))).))))).)))))))))))))))))................(((((...)))))((.(((((...((((((((.(.((((((((((.........)))).....(((((........))))).)))))).).)))))....)))...........(((((((((((...((((((((((...((.((((.(((((((((.((..(((...(((((.((......((((((((....((((((..(((..(((((((((((.((((.(((..(((....)))..))).........(((((....((((((.((.(((((((..((((((((((...((((((((((((((((((((((((..........(((((((((((.(((.(((.(.(((((......))))).).))).)))..))))).)))))).(((((.((((((((.(.((((((......)))..))).)))).)))))...)))))))).)))))))))..((....(((((((.......(((((((...........(((.((((.(((..........))))))).)))..((((..(((..(((((.((((...))))....)))))..)))..)))).....)))))))..((((.....))))....))).))))...))..(((((((((((..............)))))))))))........))))))))......))))......(((((((((((..(((...)))..))))..))).))))..........)))))))))).....((((((.....))))))(((...(((.((((((.(((((((((.((((((.(.((.((((((((...)).)))))))).)))))))....(((((..........))))).....))))))))).))..)))).))))))..))))))).)).)))))).....)))))..((((........)))).((..(((((((((.(....................(((......)))(((((............)))))....).)))))))))..)).)))).)).).))))))))..)))..))))))....(((((((.((..(((.(((.(((...........((((.((((((((((.....)))))))))).))))))).))))))..))..)))))))(((((((.......))).))))((((((........))))))....((((...)))).)))))))).....)))))))..)))...)).)).))).))))...)))).))....)))))))))).....(((((((.((((((((((((((.(((......))).)))))))..(((((((.....))))).))((..((.((((((....))))))..))..)).(((...))).))))))).))))))))))))))))))....)))))..))..((((((((((((.((((..(((((((..((.....((((...((((((........)))))).....(((...(((.......)))....)))..)))).((((((....(((((....)))))...)))))).....))...)))))))..)))).))))..))))))))..((((......))))((((..(((.(((((.((((....)))).))))))))..))))................((((......))))..........(((((......))))))))))))).)))).))).))(((((...(((....((((......))))...)))....))))).((((.(((...(((((..((.....(((...............)))....)).)))))..)))))))))))).))))))(((......)))......((((......))))..)))))..))).)))))))))).))))...))))).))))..(((...))).....)))))).....))))))).)))))))))....((.((((((...((((.((......)).))))..)))))).)).((((((.(((((((((((((..(((((((((........))))))))).((.(.(((....)))).))...(((((((((((...(((.((((.(((((..(((((((((....)))))))))))))).))))..)))...(((((.((((....)))))))))((((....)))).(((((((((((((((.((((((((((((((((((..((((..........))))..)).)))))).......((((((((.((.(((.(.(.......).).))).)))))))))).(((.((((((((.....((.(((...(((((((......))))))).))).))....)))))))))))))))).))))).))))...))))((((((((((((........)))))))))))).(((((((.(((..(.((((..((((((((.(((....((((((.((((((((......)).)))((((((.((((.((((((((.......((......))...((((((((((((((.(((((((((....(((((.((......)))))))))))))))).)))))).....((((...))))((((.......(((((((.....)))))))...))))(((((..........)))))(((..(((..(((((((((((.((((((((((....((((..(((.((((((.(((....))).)))))...).)))..))))(((((.(((.........))))))))((.(((........((((((.(((((((((....))))).....))))))))))........)))))..))).))))))).)).))).)))))))))..))).((((...((((((((((((((.(..(((..........)))..).)))))))))).)))).)))).((((((((.....(((.(((........))).)))...)))))))).....(((((.((((.((((((((..(((((((((.(......).))))))))).)).....)).)))).)))).))))).))))))))((.((((.........)))).)).((((.((.....)))))).....((((..(((.((.(((.((((((....))))))))).)))))..))))((.((((((((((..(((((.......))))).)))))))))).)).......(((((....))))))))))))).)))).))))))......((((...((((....((((((((((((..((((((((.((((((((((...............)).)))))))).)))))(((....(((((...((((((((.((((.((.(((((((((........))))))))).)).)))).))....))))))...))))).....)))((((......)))).)))..))))).)))).)))))))...))))....(((((((......))))))).))).))))))...((.(((.......))).)).))).)))))))))))).).))))))))))((((((((((((((((.........))))))......(((....))).(((.(.....))))((((((((......))).)))))((((....)))))))))))))).)).)))))((((.(((......)))))))((((((.....(((((.(((...........))).)))))...)))))).(((((((((((.....)))))).)))))..))))))))))).....)))))))).)))))))))))(((((((((((.(((((...................(((((.......)))))...((((((.((((((((((((.....((.....))(((((((((..(((((((((((.(((((((....)))).)))((((((.((..(((((((((.(((((..((((...(((((.((((...((........))....)))).)))))....))))..)))))(((((((((((.((((..((((((((..(((((((((..((((((............))))))...((((.....)))).((((..(((.(((.((((((((((....))).......)))))))))))))......)))).....((.((((((.(.((((........)))).))))))).)))))))))))))))((((((((((((((((((((.((((((((((((....))))))))....(((((.(((((....)))))((((((((.((((..(((((........)))))......(((((((.........(((((.(((.....((((((((.....((((..(((((((....(((((..(((.........))).)))))..)))))))........((((((((.(((.(((((((.....((.((((((((.(((((..(((((((...........))))))))))))))))))))...))..........)))))))........))).)))))))))))).(((((.((.((((((((....)))))))).)))))))..............))))))))...)))))))))))))))..)))))))))))).))).))...)))).)))))))))....)))))))))))...((((..(((((((((..(((((.((((((.(((((((.(((((.((((((((((((...((((((((.............(((((((..(((.((((.(((.((......)).)))))))..).))...)))))))((((.(((((((((((((...(((.....)))....)))).)))).))))).)))).(((...((((((.((.(((((((..((((....(((((...))))).))))..........(((((..(((((((.((.......).).)))))))...(((....))).)))))((((((.....))))))))))))).)).)))))).....)))...((((...(((........)))...))))(((((.(((.....))).)))))......)))).))))...))))))).))))))))))..)))))))...))))))...).))))....)))))))))..)))).))))..)))).)))).)))))))((((((.(((....)))))).))))))))))))...)).))))))))))..(((.(((((((((((((((.......)))))....((((((((((.(((((.(((((...(((.......)))))))))))))......)))))))))).(((.((....)).))))))))))))).)))..))))))).))))))))).(((((((((((....))).(((.....)))(((((((((...((((.((...((....((((..((.....))..)))).))...)).))))...)))))))))...............(((...........))).(((((((((((.((((..((((((..(.((((((((....((((((((((...))))).).))))....(((((....)))))...))))))))).))))))..)))).(((.(((...((((((((....))))...))))))).)))((((.....)))).............)))))))))))..(((((((..(((....(((((....))))).((((((........)))))))))..)))))))..))))))))(((((((((((...((((.((((((((((((.((.(((((....))))).))..)))))))..((((..(((((..(((((((((.....(((((..(((..(((...)))..))).))))))))))))))..)))))))))((((((((.(((((....))))).)))).))))....((((((((.((((((....))))))))))))))..............((((((((..(((((............))))).....)))))))).))))).)))))))))))))))...((((((....)))))))))))))))))).)).))))(((((.....))))).........))))).)))))))))))....((((.......)))).(((.....)))...((((..((.(((....))).))..))))..................(((((......))))))))))))))))((((.......))))......))))).))))...)))))).))...))).).....)))).......(((((((.......(((......))).......)))))))..........(((....))).....(((....)))....)).....
Thermodynamic Ensemble Prediction
{{...(({(({(,,....((((((((....,....,...}))))))).,||}||||{|{((,(({((((((((((.{({(({,,...,}})||}.(((({{,.,({(({,(((({...,,||...}))),)},....,.......}},)))})}}||(((((((((,,(({{.{({{((({(((((,,{|,||||}.|}}.|||,{(((((((,.{.((((((((({,..,}}),}|{((.(((((.(((((.((......)}..)))))..))))).))},.,....{(((({.,......({{,,,.|,,.|.}}})}).{|{,||{||{{((({||.}}},,}}{(((((((((((((......(((((((.,.(((((((...((((((((((..((((((((((....)))))))..)))..)))((((((((((((((((..((((.(((((((.(((((.((.,,.(((((((({((....{..(((((..((((...(((((((((.((((((.(((((.{{.(({(((...,,,,.|}|,(({({(((({.(((((((((((((((((..((((..((.(((........))).)).((((((....))))))}))).)))))))......,(((((.....))))),.(((((..((.(((.((.(({{{....,.(((((.{(((...(.(((...(((((((((((((....,.{(.,(((......}}}...,,........,|,|{,.....,,)}},}))))))))))))).))}.}..,))))))))),))))).)}))).))))))}}))))))))).}.)))).).)}))}.,}))}))))).)))))).))....))))))).....}))).,.)))))......,,,.(((((((((((.......((((.((((.,.((((.(((((,((((,..(({(((.{,,.,,,||.,,..,,{{{{{(((((({{({,,.....)}}|}))))))|{((({...{.{(((({...,)))))),.,)))))))}})}}))}})).,.}}.})}..))))).)))).,..........))))..)))}(((({{{(((((.,..((((....,.}})),.)))))))))))...)))))))))))))))))))...,,......(((((((((((,(((.(((.{.(((((......))))).}.))),)))..))))).)))))).{((((....))))).)).))))))))))))..)))))))))))))}....((((((((((...((......))...))))))))))..)))))),{,{({{{...(((((((.((((,{((.......},.})))))).)))..((((..(((..(((((.((((...))),..,.)))))..)))..)))).,......(((((((((((((....,(((((.(((......,(((,(((((((((((.,............))))))))))}..((({{,{{|{,{||.....,,{{,......{{(({,.,((({{((({{{|||{{||,,..)))})))).....,.....)}}})}})).,}})))|{,{.....))))))))))..(((.((((((.(((((((((.(((((({(.((.(((((({{...}}.)))))))).}))))))....(((((..........))))).....))))))))).))..)))).))){{{,......}))).{{{{.{{{.{{.....))..)))))},...))).)))))|(((({((({.....)},...}}}.}))}.......)))))))))))))...........,))))}.}}}}}{{....,}}..,,,))))))).)))))))..,...{{{{.....,.,..))))..}.)),,))))))))))).))))))}..{((((.((((((((((.....)))))))))).|}}}({{(((((((((((((.(((({.(((((((.......))).))))((((((........)))))).....(((...,,,.}}}((((((((((........))))))..((((((.........)))))).((((((((((((((...)))}}})))))}}}))...(((((((.(((......))).)))))))..))))..}))))..))))))),.}))))))}((({..{{.{((((.,,..,..,||..,}}},.))))).)},))))..((((.......)))).|||{|,||,,.,)),)).}}}.)))))).))).)))))),},},))))))){(((((........)))))|((((((((({,((((.{(.((.(((.((((((((((((.((((((...((((.((,....})}}}||((((,,.,((((.....,,||||}}||||((((....)))}{|,((((,,....}|||,,,{}}||,,|||||}||||....))))}})))))}},.,}||(((..{{{....,,,,(((.((((((((((((({({,((((,,((,{(((((..(((((.........)))))..))),||}.........,,(({.(((((({|(((((((({.,,....((((.(((..,,((((..{,..{((((.,.............))))}...,,.)))))..)))))))(((((...,(((((({((({.,,,,,,,,,(((......})),)|.(((((({((((.(((((.....(((...{.((((...(((((((...,{(,{{{..(((((((((((((((((((((({.((,.{{,.{((((((,..{((((.((.(((((...(((....)))....)))))}),.)))))))).))))}}..}},}}}}))))..}))))))))...,{,{.(((....)})}..}..((((....))))....))))))).})}.)}|(((((((((....)))))))))}....((((((((((((.(((((.((((....)))))))))((((....)))).,{{{{..,,,,((((.((((((((((((((((((..((((..........))))..)).)))))).......((((((({{((.(((.(,(.......}.}.))).)))))))))).(((.((((((((.....({.(((...(((((((......))))))).))).))....)))))))))))))))).))))).)))).,,)))}((((((((((((........))))))))))))....((((.(((.(((.((((...((((.........))))...))))(((((......)).)))..((.((((((((.,(((((({{....|.,,,,,|||{,{{{{{((,.((((((.((((((((({...{({({.((......))}})))))))))))).)))))).....|||,...}}}}((((.....{,(((((((.....}}|||||.,,||}|((((({{....}}..))))),|,,.{|{,,|{{{(((((((.((((((((((,,,.((((..(((.((((((.((,....))).)))))...).)))..))))(((((.({{.........))))))))||,||(.,.,....{|||{{.(((((((({....}}))}|,,..}}}})))))).,.,....})))),,))),})))))).)).)))})))))))))},},,,{(((...((((((((((((((.{..(((..........)))..,.))))))))))}}))).))))})))}}}}})...)))))))).)}.))).))).))))...{(.((((((..........,..)))))).)}))))))))))))....))))))).....)))).,....)))))))).))))|((({{..{(({.,(({{|{,}},,,,}}.}}})))).||}))))}})))))),}}.....{(((..(((.({.(({{((((((....))))))))).}))))..)))}((.((((((((((.,(((({......,)}))).)))))))))).)),....,.,{{,,....}}}}}{{{{{,,,,,,.)))}}))}}}}))}))},,..})}}}.})).)))))).(((..((.(((((.((((((({((..........,....)).)))))))).))))).))..)))..,},)))))).)))})).,)))})))}),)))))))))).)))............((((.((({.........)))))))).....((((......))))......,.....,,,)))..)}},,.,}||,....{((((((......))))))}..,,.,,..,.((((((((,....((((((.((,,((((......,...(((((((..((((((((..((((((..........))))))..)))...)))))........)))))))..))))))))))))).{(((((((({((((((((....))))..))))(((((....))))).(((((.(,(((((((,,,,((((((((.(((.,((((,...(((((({{,,{((,(((((((((((......({,(((((,{{,..,,.((((((.((((((.((((,.,(((.((.,,.(((((,,{,{,.........,},...)))))..,},)))))))).))))))(((((.......))))).......))))))}}..,,,,.....,((..,..},},,,,.......,))))})}....))))))}}}}))))|{{{(,((((.,,{(((...}}}}...})))..))))}...,,},}},}})))))))....)))}.})),))})))))...........{({((....)}}))}..{(((((((((((....,,|||,,.}}).)))))}..}}})))}.).))))}..((((.....)))).((((..(((.(((.((((((((((....))).......))))))}))))))......)))).....((.((((((.{.((((......,.)))).))))))).))..))))))),))}{(((((((((((((((((((.((((((((((((....))))))))....(({(({(((((....})}})((((((((.((({..(((((........))))}......(((((((.........(((((((((.....((((((((.....((((..(((((((....(((((..(((.........))).}))))..)))))))........((((((((.((({(((((((.....{{.((((((((.(((((..(((((((...........))))))))))))))))))))...}}..........)))))),...,,,}.}}}.))))))))}}}}.(((((,({,((((((((....)))))))).))))))).........,,}..))))))))...)))))))))))))))..)))))))))))).}},.}}...)))).)))))))))....))))))))))))))))))).(((((....}))))...((((((.(((((((.(((((.((((((((((((...((((((((....{{{{.....{{||||{..,{,.((((.(((.((......)).)))))))..}.)}...}}}}}}|((((.(((((((((((((..{(((.....)}),}..)))).)))).))))).))))|(((...((((((,((.(((((((..((((....{{{||,..}))))}))})}}}}}}}},.{((({..(((((((,((,,...,,,.},||||}||...(((....))),)))))|{{{||.....))))))))))))}.}}.}}}}}}.....}}}.........|||{,,,..,.,|||.....,,||(({,{{|...,}))).))))),.,...)))).))))...))))))).))))))))))..)))))))...))))))...))))))...))))).))))).)).))).))..)).))))))))))))))},{{{|,||},....,)))})),))))).....}).))))))))))))))}(((.(((((((((((((((.......)))))....((((((((((.{{{{{.(((({.,,(((.......))}))))},,}}....,,.)))))))))).,{{.{{....}}.)}})))))))))).)))...{(((((.((..(((((((({..,.((((....))))(({.....}}}(((((((((...{{(({({{{.,,,..}}}}}}}{|.....}}.{|{|.....}})}..,}}...))))))))).....,,,,,,,,..{{{,.....})}}.({{{(((((((((((.((((..((((((..(.((((((((....((((((((((...))))).)}})))..,.(((((....)))))...))))))))).))))))..)))),{((,(((.,,{(((((((....)))},.,|}},}},.})))|{|,||,.)}))},...........))))))))))}...|})))...{{{{...(((({....))))).)))),.....,(((((((|{(((((((...(((.(((((.{((((((((({(({{{(((((((({....|})))|({(((((....}}}||,||,,|||||||{{({({,{({(({.,(((((((((..||.|{{{{,,{{{,,{,,...,,},.}}},}))}))))))}}))..)))))},,,((((((({.(((({....))))).)))).))))....((((((((.((((((....)))))))))))))).,{||,..|||||||(((((((..(((((.,........}.))))).....)))))))},}}},},})))})}})}}},,,...((((((....))))))...}}}}}}})))))},)}.,||}}}}}}}),,||....,.,{{{{{.{(,{{{{{,.,.||.|}||||...|||,|||{{{((,,,,,}},...||||,,||,{||..,.))),))..))))}},,,,,...}}},}))}((({{......))))),,,...{{|.{{{,....,,.}))}}}},},))))).)))...}})))))))),,)))))))))))))..)).)))))|((((((......,(((......))).,.....))))))}......,,,,|||....))}.....{,,....,},...})}.....

Transcripts

ID Sequence Length GC content
GCACUGCUGAUGAAACCUGGCGCCGGAACCCGCCAGCCCUCGGCGCCCA… 7343 nt 0.5274
Summary

Enables L-arginine transmembrane transporter activity; L-histidine transmembrane transporter activity; and L-lysine transmembrane transporter activity. Involved in carboxylic acid transport. Located in apical plasma membrane and basolateral plasma membrane. Part of protein-containing complex. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in rats demonstrated that the SLC7A1 was identified as an orthologous gene associated with inflammatory processes in a single-cell transcriptomic analysis of radiation-induced lung injury [Shi et al. DOI:10.17305/bb.2024.10357]. In rhesus macaques, transcriptomic profiling of hypertrophic cardiomyopathy identified the SLC7A1 as a shared upregulated differentially expressed gene between affected macaques and pediatric human HCM cases [Rivas et al. DOI:10.1038/s41598-024-82770-4].