| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGUUUGUAAUGAUAGGGCGGCAGCAGCAGCAGCAGCAGCAGUGGUGGAA… | 9645 nt | 0.3540 |
This gene encodes a member of a heteromeric, sodium-independent, anionic amino acid transport system that is highly specific for cysteine and glutamate. In this system, designated Xc(-), the anionic form of cysteine is transported in exchange for glutamate. This protein has been identified as the predominant mediator of Kaposi sarcoma-associated herpesvirus fusion and entry permissiveness into cells. Also, increased expression of this gene in primary gliomas (compared to normal brain tissue) was associated with increased glutamate secretion via the XCT channels, resulting in neuronal cell death. [provided by RefSeq, Sep 2011]
A study in human HT-29 colorectal adenocarcinoma cells demonstrated that exposure to arsenic trioxide did not significantly change the expression of the SLC7A11 protein, as shown by immunoblotting [Kazuta et al. DOI:10.1016/J.Legalmed.2026.102774]. In a separate investigation of human heat stroke patients, transcriptomic analysis identified the SLC7A11 gene as a mechanism-related factor, with its transcription potentially suppressed by p53 activation within the MAPK14/p53/SLC7A11/GPX4 pathway to promote ferroptosis [Yin et al. DOI:10.1186/s12920-025-02188-3].