Basic Information

Symbol
SLC7A11
RNA class
mRNA
Alias
Solute Carrier Family 7 Member 11 XCT Solute Carrier Family 7 (Anionic Amino Acid Transporter Light Chain, Xc- System), Member 11 Calcium Channel Blocker Resistance Protein CCBR1 Amino Acid Transport System Xc- Cystine/Glutamate Transporter Solute Carrier Family 7, (Cationic Amino Acid Transporter, Y+ System) Member 11 CCBR1
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden unexpected death diagnosis

MANE select

Transcript ID
NM_014331.4
Sequence length
9645.0 nt
GC content
0.3540

Transcripts

ID Sequence Length GC content
GGUUUGUAAUGAUAGGGCGGCAGCAGCAGCAGCAGCAGCAGUGGUGGAA… 9645 nt 0.3540
Summary

This gene encodes a member of a heteromeric, sodium-independent, anionic amino acid transport system that is highly specific for cysteine and glutamate. In this system, designated Xc(-), the anionic form of cysteine is transported in exchange for glutamate. This protein has been identified as the predominant mediator of Kaposi sarcoma-associated herpesvirus fusion and entry permissiveness into cells. Also, increased expression of this gene in primary gliomas (compared to normal brain tissue) was associated with increased glutamate secretion via the XCT channels, resulting in neuronal cell death. [provided by RefSeq, Sep 2011]

Forensic Context

A study in human HT-29 colorectal adenocarcinoma cells demonstrated that exposure to arsenic trioxide did not significantly change the expression of the SLC7A11 protein, as shown by immunoblotting [Kazuta et al. DOI:10.1016/J.Legalmed.2026.102774]. In a separate investigation of human heat stroke patients, transcriptomic analysis identified the SLC7A11 gene as a mechanism-related factor, with its transcription potentially suppressed by p53 activation within the MAPK14/p53/SLC7A11/GPX4 pathway to promote ferroptosis [Yin et al. DOI:10.1186/s12920-025-02188-3].