| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGAGAGCAGCGCACCGGCAUGGGCAGGCGGCCGGCGGCGGAGGGCGGCU… | 5601 nt | 0.4413 |
This gene encodes a member of the sodium-hydrogen exchanger (NHE) protein family. These proteins are involved in sodium-ion transport by exchanging intracellular hydrogen ions to external sodium ions and help in the regulation of cell pH and volume. The encoded protein is localized to the apical membrane and is involved in apical absorption of sodium. [provided by RefSeq, Jun 2016]
A study in mouse cardiac mesenchymal stem cells demonstrated that overexpression of HDAC11 induced transcriptional reprogramming, activating cell cycle pathways and promoting proliferation while suppressing various metabolic and transport processes [Zhang et al. DOI:10.3390/biom15050662].