| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAUCCAACCCCGGGCCGCGGCCAACUUCUCUGGACUGGACCAGAAGUU… | 2561 nt | 0.5685 |
BAG proteins compete with Hip for binding to the Hsc70/Hsp70 ATPase domain and promote substrate release. All the BAG proteins have an approximately 45-amino acid BAG domain near the C terminus but differ markedly in their N-terminal regions. The protein encoded by this gene contains a WW domain in the N-terminal region and a BAG domain in the C-terminal region. The BAG domains of BAG1, BAG2, and BAG3 interact specifically with the Hsc70 ATPase domain in vitro and in mammalian cells. All 3 proteins bind with high affinity to the ATPase domain of Hsc70 and inhibit its chaperone activity in a Hip-repressible manner. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the BAG3 gene, an anti-apoptotic protein and indicator of cellular stress, was downregulated in subcutaneous adipose tissue during both short-term and long-term weight loss interventions [Bollepalli et al. DOI:10.1038/ijo.2017.245]. In a separate forensic investigation of human cadaver liver tissues, the BAG3 was found to be downregulated more than sixfold in decaying tissues compared to a control, contributing to the apoptotic thanatotranscriptome profile observed with increasing postmortem interval [Javan et al. DOI:10.1007/S12024-015-9704-6].