Basic Information

Symbol
BAG3
RNA class
mRNA
Alias
BAG Cochaperone 3 BAG Family Molecular Chaperone Regulator 3 BCL2 Associated Athanogene 3 Bcl-2-Binding Protein Bis Docking Protein CAIR-1 BAG-3 BIS Bcl-2-Binding Protein BIS Transcript 2 Bcl-2-Associated Athanogene 3 BCL2-Binding Athanogene 3 CAIR-1 CMD1HH CMT2JJ HMND15 MFM6
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference Other applications

MANE select

Transcript ID
NM_004281.4
Sequence length
2561.0 nt
GC content
0.5685

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-902.10 kcal/mol
Thermodynamic ensemble
Free energy: -947.87 kcal/mol
Frequency: 0.0000
Diversity: 593.18
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((((((...((((.((((((......(((((......)))))(((((((.(((((((.((((((...........(((((((((.((.....)).)).)))))))...................((((((((((.((..........((((((((.....)))))))).((((((((((....))))...)))))).)))))))))))).....)))))))).))))).))))))).(((((.(((.((....)).)))..(((((......)))))....................)))))((((((..(((......)).)..))))))((((((((....)).))).)))....((((((((((...((((((.........((((((((..((((((..(((((..(.(((........(((((.......(((((......))))).(.((((((((((((((....((((........))))......)))))))....))))))).)...((((((((((....(((((((.((((.(((.....(.((((.((..(..((.((((..........))))..))..)..)).)))).).....)))))))...))))))).....((((((......))))))(((((....))..))))))))))))).)))))))).))))))..))))))...))))))))((.(((((....((((.................)))).....)))))))(((((.(((......))).)).)))......(((((.....)))))..))))))(((((....((((((((((..............(((...((((((.......))))))....))))))))))))).))))).))).)))))))............((((((...(.....)...)))))).)))).)).))))..((((((.((((...(((.((((((((((((.(((((((..(((((((((.........)))....((((((..(((((.......(((((((((.((((((((((..(((((....)).))).((((.((((.((((((((.....))))).))))))).)))))))))).)))).))((((..........))))..))))))).((.((....)).)).....)))))..))))))....((.(((................((.((((((((((((..(((((.....................)))))((((..((..........))..))))...............((.(((((((......)))))))))....(((((((......(((..(((((((((......)))..))))))(((((((..(((((((((((.(((((((((......((((.((((.((((((..((((.(((((.....))))).).)))..))))))((.((((((.........))))))))((....)).....((((.......))))..)))).))))...........(((((((..(((.........)))..)))))))..))).)))))))))))))))))..).....))))))...)))......(((.......)))......((.(((((.....))))).))(((.(.((((((..(((((((((.((((((((..((((((...(((((.((.((.(..((((..........((((((.(((....))).)))))).....))))..).))..))))))).)))))).)).........)))))))))).))))).)))))).)))))))))))....(((......)))......)))))))))))).))))).))(((((.((((........((((((...........................))))))((.(((....(((((((((((((((((......((((((((............((((....)))).(((.((...(((((((((((.((((...((.(((((....))).)).)).)))).)).....((((((((.(((((.(((.........((.((((((((....))))))))))))).))))))))))))))))))))))...............))))).(((((.(......).)))))(((((.((((..(((...)))..)))).))))).))).))))).....))))).......)))))).))))))))))).)))))))))...((((....))))...)))))).)))).))).))))...))))))))..))).))))..))))))((.((((((..........)))))))).((((.(((.(((((((.....)))))))..)))))))(((((((((......)))))))))..........(((((((((....))))).........))))....((((......))))..))))))))...(((.((((..(((((........)))))..)))).)))............
Thermodynamic Ensemble Prediction
.((((((((...((((.((((((......(((((......))))}(((((((.(((((((.((((((...........{((((((((.((.....)).)).))))))}.........,.........((((((((({{((..........((((((((.....)))))))).((((((((((....))))...)))))).)))))))))))).....)))))))))))))).))))))).(((((.{(,.((..|||},}}},.(((((......)))))..............,|.,|.))}}|((((((..,((|....,)),)..))))))}|,,((({,.|||}.}}}.}}),..,||||{{(((({..((((((....,,,..((((({{{..((((((,,{{{{(,,({((.........(((((.......(((((......))))).{.((((((((((((((....((((........))))......)))))))....))))))).}...((((((((((,{..(((((((.(({(((((.....,.((((.((..,,,((,,(((..........)))),,},.,)..)).)))).}.....)))))))...)))))))..},.{(((((......)))))}{{{{{....))..))))))))))))).||||||||.||||||,.}}}}},,}}))))})))||.|||{,....((((,...{,,.,,.....)}})))...}})))}}))|||((.(((......))).)}.)))..}}},|||,{.,,,,||||},,||,...,||||....{|||||||||..............|||,,,|{((((.......)))))).,..)}}|||}}}}}}},))))),)})})))))),.}}})))..))))).},....,,.,..,...))}....)))).)).)))),.((((((.((((...(((.((((((((((((.(((((((..(((((((((.{{.,,,,.,,,....((((((..(((((..,....((((((({(.((((((((((,.((((,...,)),))}.{(((.((((.((((((((.....))))).))))))).)))})))))).)))).),((((..,....,..))))..))))))).|...,...|||,},.},}.)))))..))))))....((.({({{{{{{{{{{{,.{{{{(.{,,,,,|||||{,.(((((...............,,....))))){{((.,((........,.},..)))).,.,.,.........,{,(((((((......))))))}},....{{(((((...|,,||...(((((({{({,....)))..))))))...{{{,..(((((((((((((((((((((.,,...((((.((((.((((((..((({,(((((.....})))).).)))..)))))){{.((((((......,,.})))))}}{{....)).....((((.......))))..)))).))))...........{((((((..(((.........)))..)))))))).))).)))))))))))))))))..,..,,,.,|{{{,..|||..,...,||.......}}}.,{|..{{.{{{{|,.,,.)))}}.},,||.|.((((((..(((((((({.(((((({{..{(((({.,,({{{(.((.((,{|,{,{{.,....,,,.{(((((.(((....))).)))))}.....))}}..}.},..)))}))).)))))).)).....,}}.)))))))))).))))).)))))).}})}}},}}|}.,..{{{..,,,.))).....,)),))))))),,}))))).))((((,,((((........((((((...........................))))))(,{(((....(((((((((((((((((((((..{((((((....,.,......((((....)))).,{{.{{.,.(((((((((({.((((,,.((.(((((....))).)).)).}}}}.},.....|{((((((.(((((.{{,..,,,,...||,|(((((((....)))))))}})))}.)))))))))))}))))))))))...............)))}}...,{({({,......,))))}|(((.((((..(((...)))..)))).)))})))))},)..)))))},,))).......))))))}})))))))))).)))))))))..,||||,,,,))).,,.)))))}.)))).))).))))...))))))))..))).))))..)))))),|.((((((..........)))))),}.,.,,.,{{.(((((((.....)))))))..}||||||(((((((((......)))))))))...,,,,.,.{{{{(((({....})))).....,.,,}}}}..,,{{{{,....,))))..)))))))).,.{((.((((..(((((........)))))..)))).}},............

Transcripts

ID Sequence Length GC content
GCAUCCAACCCCGGGCCGCGGCCAACUUCUCUGGACUGGACCAGAAGUU… 2561 nt 0.5685
Summary

BAG proteins compete with Hip for binding to the Hsc70/Hsp70 ATPase domain and promote substrate release. All the BAG proteins have an approximately 45-amino acid BAG domain near the C terminus but differ markedly in their N-terminal regions. The protein encoded by this gene contains a WW domain in the N-terminal region and a BAG domain in the C-terminal region. The BAG domains of BAG1, BAG2, and BAG3 interact specifically with the Hsc70 ATPase domain in vitro and in mammalian cells. All 3 proteins bind with high affinity to the ATPase domain of Hsc70 and inhibit its chaperone activity in a Hip-repressible manner. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the BAG3 gene, an anti-apoptotic protein and indicator of cellular stress, was downregulated in subcutaneous adipose tissue during both short-term and long-term weight loss interventions [Bollepalli et al. DOI:10.1038/ijo.2017.245]. In a separate forensic investigation of human cadaver liver tissues, the BAG3 was found to be downregulated more than sixfold in decaying tissues compared to a control, contributing to the apoptotic thanatotranscriptome profile observed with increasing postmortem interval [Javan et al. DOI:10.1007/S12024-015-9704-6].