| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUCUCCGCUCCGCGAAUCUCCUCCGGCCACUGCCGCCGCGGUCGCCUC… | 4067 nt | 0.5488 |
This gene encodes a prostaglandin transporter that is a member of the 12-membrane-spanning superfamily of transporters. The encoded protein may be involved in mediating the uptake and clearance of prostaglandins in numerous tissues. [provided by RefSeq, Dec 2011]
A study in rhesus macaques identified the SLCO2A1 as a shared upregulated differentially expressed gene in left ventricular tissue from animals with hypertrophic cardiomyopathy compared to adult human HCM cases, establishing its association with this cardiac disease process [Rivas et al. DOI:10.1038/s41598-024-82770-4].