| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCCUCGCAGCAGUCAGUUGGGAGCUGGAGGGAGGGAGAGGGAGACGCA… | 7964 nt | 0.5940 |
Enables Roundabout binding activity. Involved in axon extension involved in axon guidance; motor neuron axon guidance; and negative chemotaxis. Predicted to be located in extracellular region. Predicted to be active in extracellular space. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice and humans demonstrated that the SLIT1 is predominantly expressed in the atrial cardiomyocyte cluster aCM2, which is associated with metabolic regulation of cardiomyocytes in the right atrium following myocardial infarction [Bian et al. DOI:10.3892/mmr.2025.13680].