| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACAGCCUGGGAGGGGAGAAGGAGUUGGAGCUCAAGUUGGAGACAGCG… | 722 nt | 0.4820 |
Sarcoplasmic reticulum Ca(2+)-ATPases are transmembrane proteins that catalyze the ATP-dependent transport of Ca(2+) from the cytosol into the lumen of the sarcoplasmic reticulum in muscle cells. This gene encodes a small proteolipid that regulates several sarcoplasmic reticulum Ca(2+)-ATPases. The transmembrane protein interacts with Ca(2+)-ATPases and reduces the accumulation of Ca(2+) in the sarcoplasmic reticulum without affecting the rate of ATP hydrolysis. [provided by RefSeq, Jul 2008]
A study in pigs demonstrated that the SLN is a mediator of sarcoplasmic reticulum calcium ATPase (SERCA) uncoupling in skeletal muscle non-shivering thermogenesis, though its specific role in large mammals is considered controversial [Yang et al. DOI:10.3390/ijms24087431].