| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGAGUCACUCCUGCCUUCACCAUGAAGUCCAGCGGCCUCUUCCCCUUCC… | 596 nt | 0.5218 |
This gene encodes a secreted inhibitor which protects epithelial tissues from serine proteases. It is found in various secretions including seminal plasma, cervical mucus, and bronchial secretions, and has affinity for trypsin, leukocyte elastase, and cathepsin G. Its inhibitory effect contributes to the immune response by protecting epithelial surfaces from attack by endogenous proteolytic enzymes. This antimicrobial protein has antibacterial, antifungal and antiviral activity. [provided by RefSeq, Nov 2014]
A study in mice demonstrated that the SLPI mRNA and protein levels were significantly elevated in lung tissue and plasma in a cecal ligation and puncture model of sepsis-induced acute lung injury [Fang et al. DOI:10.1155/ijog/5684300].