| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCACUUCUGAGCACGGAGCAAUGGCCUCUCGCUGGGCUGUGCAGCUGC… | 527 nt | 0.6262 |
The protein encoded by this gene is a member of the Ly6/uPAR family but lacks a GPI-anchoring signal sequence. It is thought that this secreted protein contains antitumor activity. Mutations in this gene have been associated with Mal de Meleda, a rare autosomal recessive skin disorder. This gene maps to the same chromosomal region as several members of the Ly6/uPAR family of glycoprotein receptors. [provided by RefSeq, Jul 2008]
A study in rats demonstrated that arylsulfatase B (Arsb) gene expression was significantly altered in liver tissue on day 7 following a 20% total body surface area burn injury [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025].