Basic Information
MANE select
Transcripts
| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGGCGGGUCUACCCGCGCGGCCGCGGCGGCGGAGAAGCAGCUCGCCAGC… | 34400 nt | 0.4008 | |
| AGGCGGGUCUACCCGCGCGGCCGCGGCGGCGGAGAAGCAGCUCGCCAGC… | 34310 nt | 0.4007 | |
| GCGCGCGUCCUCACCCCCUCCUUCCCCGCGGGCGGCGGCCAGGCUCCCU… | 34626 nt | 0.4029 |
Summary
The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signal of the transforming growth factor (TGF)-beta, and thus regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. This protein is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. The phosphorylation induces the dissociation of this protein with SARA and the association with the family member SMAD4. The association with SMAD4 is important for the translocation of this protein into the nucleus, where it binds to target promoters and forms a transcription repressor complex with other cofactors. This protein can also be phosphorylated by activin type 1 receptor kinase, and mediates the signal from the activin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012] CIViC Summary for SMAD2 Gene
Forensic Context
A study in rats demonstrated that radiation-induced lung injury significantly altered mRNA and miRNA expression profiles, with SMAD2 expression being inhibited by the inhibition of let-7i or miR-21 in cell experiments using rat lung type II pneumocyte cells [Xie et al. DOI:10.1186/1748-717X-9-111]. A study in rats demonstrated that the SMAD2 exhibited significantly altered gene expression on day 1 post-burn injury and demonstrated a change in gene expression across all measured time points (days 1, 2, 4, and 7) following a 20% total body surface area scald-burn [Jayaraman et al. DOI:10.1016/j.jss.2007.05.025].