Basic Information

Symbol
SMAD3
RNA class
mRNA
Alias
SMAD Family Member 3 JV15-2 HsT17436 MADH3 Mothers Against Decapentaplegic Homolog 3 Mothers Against DPP Homolog 3 MAD Homolog 3 HMAD-3 HSMAD3 Mad3 MAD, Mothers Against Decapentaplegic Homolog 3 (Drosophila) SMAD, Mothers Against DPP Homolog 3 (Drosophila) MAD, Mothers Against Decapentaplegic Homolog 3 SMAD, Mothers Against DPP Homolog 3 SMA- And MAD-Related Protein 3 Mad Protein Homolog Mad Homolog JV15-2 HSPC193 SMAD 3 LDS1C Smad3 LDS3
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_005902.4
Sequence length
6464.0 nt
GC content
0.5114

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2289.20 kcal/mol
Thermodynamic ensemble
Free energy: -2405.95 kcal/mol
Frequency: 0.0000
Diversity: 1709.22
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((......(((((.(((.(((...(((....)))..))).)))))))).((((((((((..(((.(((.(((.((((((((.((((((((((((((((((.((((((((.(((.((((.((.(.((((.((..(((..........))).(((.(((((((((((((((.(((..(((...)))..)))((.((.(((.........))).))))...)))....))))))))).))))))....((((....((((...))))))))((((((....))))))......)))))).).)).)))).))))).)))))).))))))))))))))).))).((((((((..(((((.((.(((((((((((.(((((.....)))).).))).)))))))).(((((((((((....(((((((((.........))))))))).))))).))).)))..))))))).)).))))))....((((((((((((....((........))..))))))))))))..)))))))).))).)))......(((..(((.....))).)))..((((((..........)))))))))..)))))))))).(((((((((......(((((.(((((((((...((.(.((((.((((((((...((((.(((..............))).)))).(((((.((((.(((.(((((..((((..(((((....((((((((...)))........((((((..(((((((((((..(((((.((..((((....((..(((((((.....((..((((.(((.....(((((((.((((((((((((((((((..(((.(.(((...)))).))).))))))).....(((((((........))))).)))))))))...........((((.(((..(((.((((((.(....))))))))))..))).))))))))))))))))))))))..))...)))))))..))...))))..)).)))))...))))))..................(((((.((((((((..(((((((......((((.(........).))))........((((((.(((((((.((.(((.(((.....((.....))...))).))).))))))))).(((..(((((...((((((((.....(((.....(((((.((........))))))).....)))(((((((((....)))......((((((.(.(((.((((...)))).))).))))))).....(((((((((.((((((((((....)))))))))).).((((...((((.....))))((..((.(((((..(((((..(((..........)))..)))))..))).)).))..))........))))..))))))))))))))....))))))))))))))))))))))...(((((((((.(((((........)))))((((......))))...(((((......)))))...((((((((.((((.........(((((((((((....((((....))))....(((((((.........))))))).(((((.(((((((..((((.........))))....)))))))(((((((((.......)))))...)))).....(((((((..(.(((((....((((((.((((.((.((((......((((((...(((((.((.(((...(((((((..(((....)))..))))))).....))).))))))).)).))))...)))).)))))).))))))...((((((.....(((..((((((((..((((.((((..(((((((.....)).(((((((..........)))))))....)))))((((...(((((((.....)))))))....))))....(((.....)))((((((..((((...(((..((((....((((((.((((((((((.....((((((...((((((...........))))))..))).......))).....))))))))))))))))..))))..)))..)))))))))).........)).))))))))))))))))).((((.......))))..(((....))).)))))).((((((...((((........))))....)))))).........((((((..((((((((((.(((((((.(..((((...((.((((.(((.......))))))).)).))))..)))))).))...)))).))))))))))))))))))..)))))))..((((..(..(.(((((((((((((((((.(((((((((.((((.(((((((((((((((((.(((((((((((.((......)).)))))))))))))))))............((((((((.(((((((...((.(((((..........))))).....))..)))))))))))))))...............)))))))).((((((...))))))((((((((((((((.((...((((((((.(((((...)))))(((((..((((((((((((((((...)))))).((((.((.....))))))((((((.((..((((((..((((((...))))))...))))))..)).(((((......))))).(((((..((((((((((((....((((((((((.(((((((.((((((((((......)))))))).)))))).)))...))))...(((((((((((((........((((.(((.((((((((((((((......((((((..(((.......((((((((.(((((.((((...(((....)))))))((((((((.........((((((((((((.(((((.((........)).))))).((((..........))))........))))))...)))))))))))))).....)))))(((......)))....(((.((((((.........(((((...((.((((((...(((((((((.((((..(((.(..(((((((((((...))))....)))))))..).)))(((((........)))))..((((((.....))))))....)))).))))).))))((((...........))))..................))))))..)).)))))........)))))).))).)))))))).....(((((((.(((((((.((((..(((((........)))))........))))))))))))))))))...................((((((((((....))).))))))).......(((((((((...))))))))))))....))))))......)))))))))))))).)))...))))........)))....))))))))))((((((..........))))))((((((((........))))).)))((((.(((((..((((..(((.(((.......))).)))..)))))))))..))))..(((((((.(((.((((.......(((((((((((((....))))..(((((((((((..((((((((((((((((((((.(((........))).)))........))))).))))....))))))))...))))...)))))))........((((((.((......))))).)))))))))))).((((((((((((.(......((.((((((.(((.((((((.....(((..(((.(((((..((((((((...(((...(((((((....))))))).)))..)))))))).........(((...)))....))))).))))))..))))))..))).)).)))).))......).))))))))))))((.....)))))).))).))))))).(((((..((((((...))))))..)))))((((....))))..))).)))....))))))...))))))..)))))........(((........)))...))))))......))))))))))...)))))...(((((((((((((.(.(.(((((((....((((..(((((..(((((((....)))).)))....)).))).))))......(((((....((((((((((((((((...(((.((......))..)))...))).)))).((((((((((.(((....))).)))))..(((((((((.(((..(......)..)))..(((((....)))))...)))))))))....(((((((((((((.....))))))))))).)).....))))))))))))))....)))))((((((((..........(((((((........(((((((((...)))))))))))))))).(((((((((.......)))))))))(((((.(((..(((((((((..((((..((((((((.((((((.....)))))...).))))))))..)))).(((((((......)))))))...)))))))))..)))......(((.....))).))))))))))))))))))))).).))))))))))))))))))))).))))))))))....))))))..(((((.(((((.(((.......((((((((((..((((.((.........(((((((......((((.......((((.((((((((((...((((....)))).......((((((.....)))))))))))))))))))).((((((((.((((......)))).))))).))).))))......))))..)))..)).))))..))))).)))))..))).))))).)))))))).)))).).))))))))))))))).)).((((..((((((((..(((((.(((.(((.((((.((((((....(((((((.(((((..............))))).))))))).........((((((.(((((((...)))))))))))))(((((((((.......((((((((((((((.((.(((..(((((...(((((((((((((....((((..(((((.......)))))..))))((((((((...))))))))........(((((((((((((((((((......)))))).))).....(((.(((((..((.((....)).))))))).)))))))))))))..(((((((((.((((((((.....)))))))))))).........((((((.(((...((.((....)).))...))).))))))....)))))....))))))).))))))...)).)))..))).)).))...))))).))..))))).......)))))))))(((........(((((.(((.....((((((.(((((...)))))...((((((((...))))))))......))).))).....))).))))).......)))..(((.((((((((.((.((..((((((.......)))))).)).))))).))))).))))))))).)))))))))).)))))))))....))))..))))...((((((((...)))))))).)))))))).)..)..)))).....((((((((((((..................))))))....)))))).......)))))(((((((...)))))))...((((((.((((......)))).))))))((((.....))))...)))))))))))...(((((....)))))...((((((((((......(((.((....)).)))......)))))))))).((((..(((.....))).)))))))).)))))))).....)))))))))(((((((.(((....((((((..((((((...((((....))))..)))))).....))))))..))))))))))........(((((.((.....(((((.((((..((((........((((((((....))))))))((((......((..(((.((((....)))))))...))....))))(((.(((((.(.(((.....))).).))))))))...))))..)))))))))...)).)))))))))))).))).))))).))))))))))))))))........))))))))))))))..))))).))))))).))))).)))))(((((((((((((....))))............((((((((((((((....)))).((((((.....))))))(((.....)))...))))))))))......)))))))))......))).)))).).)).))))))))))))))...)))))))))........))))........
Thermodynamic Ensemble Prediction
{{,,......(((((.(((.(((...(((....)))..))).)))))))).((((((((((..(((.(({.({({{{(((((,.,(({{((,((((((((((,((((((((((({,(({(,,{{{{,({{.,||||{{......||..|||,({|{{{{,.,{{{((((((((((,,((,...,}}..}}}(((((((((..((.....(((.((..((((((((........)))))).,,.}}..))))).....))..)))))))))((((((....))))))....}}}}}}},{|.||{|{||.{||||{||||||,||}|}}}}}},},,},))).||{{((((,.((((({,(.(((((((((((.(((((.....)))).).)))}}))))))).||||||,||,{.}},(((((((((.........))))))))),)))))}),)})))}})))))))}))}))))))}}}.((((((((((((....{,........)}..)))))))))))).,))))))))}))).)))}}}}}}}.,}}.,,}}}}}}.)}}))}.{(((((,,....,...)))))})))..)))))))))).(((((((((......(((((.(((((((((...((.{.((((.((((((((.,.((((.(((..............))).)))).(((((.((((.(((.(((((..((((..((((({...{(((,,,,...|||...|....((((({.,(((((((((((..(((((.((.{((((....((..(((((((.....,(..((((.(((.....(((((((.((((((((((((((((((..(((.(.(((...)))).))).)))))))....{(((((((........))))).)))))))))...........((((.(((.,(((.((((({,(....)))))))))).,))).))))))))))))))))))))))..}),..)))))))..))...)))),.)).)))))...))))))..,...............(((((.((((((((..(((((((,.....{(((.{...,,,..,.||||....{{|.((((((,((((({{{((.(((.(((.....((.....}}.,.))).))).))))))))).,{{..(((((...((((((((.....(({.....{{({,|((.......,}}))}}}.....)))(((((((((,,,,|||{{{{{.((((((.{.(((.((((...)))).))).}))))))...,,((({{{{{{.((((((((((....)))))))))).,.,{{{...((((.....)))).|,.,,.||,,|,,(((((..(((..,.......)))..))))).|)))|}||}...,)}}}...,.})))..}))))}}}))))))....)))))))))))))}))))))}),,,((((({{((,{({((,,,,....}}}}}((((......})))...{{||(,,,.,.)))))...{((({{{{.(({(,.{{{{{{.{{{(((({{{{..,,||,,,,,,)))}....(((((((.........))))))).(((((,(({{{{|,.((((,..,.|||{|||,.,,.}}|}}},,{,,{((({..,,,,{}}}}|{{{|||||||,,|(((((({{({((,(({(,((.,(({.,{|}},,}|,||},,,,,||((((..,(((|,||(|((|...(((((,,.,{{,.}}}})}..,))))))}},.}))).,))))))}))}}))...{||||.,,))))|{((({...})))}},.,,,.{{{..((((((((..((({{((((....,{{{,.,{|,|{.(((((((..........))))))),..|||.,,{{{(...(((((((,,...})))))),},,}}}}.,..|||||,..,}}((((((..((((...(((..((((....((((({,((((((((((.......(((({..,..,,}}}}}....,,,{|||||,,......,,,)))}.....)))))))))))))))),.))))..)))..)))))))))).,.....,.)).))))))))))))))}}}.|||{......,))}}}}|}))}}.,}}))}))},.((((((...((((........))))....))))))..,,|,{{{((((((..(((((((((({({(((((.(..((((...((.((({,(((.......))))))).)).))))..)))))).)),..}))).))))))))))))..)))}}|}|||||},.((((..{..{.(((((((((((((((((.(((((((((.((((.((((((((((({(((((.(((((((((((.((......)).))))))))))))))))}.......,,...{(((((((.(((((((...({.(((((..........))))).....))..))))))))))))))}...............)))))))).((((({...})))))((((((((((((((.((...((((((((.(((((...)))))(((((..(((((((((({(((((...)))))}.(,,{{({,....||||||{{{{(,.((((({{{{{||,,||||||||{,||},,,|{|{||((((.(((((......))))),||{(((((((..(((..,,(({.((.(((({{,.{((((((.,{((((((((......)))))))).}}))))}}},.{((((((({{{{{.............}}}}.}|}})))))}.....,.........,,,,}}|||}.}}}}}}.}}}}|||||..,(((((.((((..,(({..,,)}}))))((((((((.,,....}}((((((((({{,.(((((,((.......,)).))))).,|||.{,,,{{.,,}},}....,,.,)))))}...)))))))))))))).....)))))(((......))}....((({.(((((((....,{..(((((((((..........(((((((((.{(((..(((.(..(((((((((((...))))....)))))))..).)))(((((.{,...,})))))..((((((.....))))))....))),.))))).)))){(((.{,,{..,{{,||||{....{{{{{..,,,...}}},.}||||..,,,,,,....,,...,||||||}|||{||}|,,,,.(((((((.(((((((,,((((.(((((........))))).,,,..},},)))))))))))))))).,,.....(((.((((.....(((((.,({{{....(((((((....{((.(((....))).)))...)))))))..))))}},)}}}}))))))),(({({{{{||||{{.{{{..,(({,,,,{({{,...,}..))}}.,,{{||,|,||||||||||}.||||||||,,,,,,,,))}}}.,}}||,|||(((((((((({.(,.,{{{,.,,,..|||||||..||||||},}.,}||||,,,,,}}|}|||{|}}}.}}))))).,....,,.,||,|||,}||..(((((({{{{({.((((((((({((((((((({.(((......,.))).))}........))))).)))),,.,))))))))...,}))..,)))))})}}),,})))))})))))))))..}}..))))))).})))....((((((,{,,,.,......||}|||(((((....))))},,,}}|,|.}|{|}|||}}}|{((({((({{.,,,....|||||{,,,,)))))))},,|{{|||||,,,........})))}}}}{{{((((,,,,.|.|||,{.,,.,),,}),}})))))).,,)}}}}},)})))))))))))|{{{||{,||||,}||||||}|{((|.(((((..((((((...))))))..)))))..|}}}}.,)}),,,)),,}}.}}}}}},,||||}}}},.,})))}.........(((........))){{{{|...}}))}..))))))))))...)))))...(((((((((((((.{{({((((,(({{{..,((..((((({{(,{,{{,{{,.||,,.})}))).},}.)))))))}..}}.|||||.{{,{((((....)))))}|..,,,,.{{......}}..}}}.,,}}|{,|{{((((({(((((.(((....))).))))).,((((({(((.,((..,......}..}||..(((({....)))))...}|}}|})}}||,.|||,|{{((((,({{{{{,||,|,,,),)}.)}})}}.)}}}.|||}}||||..,))})}}})|{(((({.....}}))}}|..,.,..|{{{({{,,||||}},}}}|||,,.,,,,}}}.|{{||||||,,,,,},}}}}}}}}|||..{.(((..(((((((((..((((..((((((((.{(((((.....)))))...}.))))))))..)))).(((((({......)))))))...)))))))))..)))..)))...}}}))})}..}},.((((....)))),},,,.,.))))))))))))))))))))).)))))))))),...})))))..(((((.(((((.(((.....,.((((((((((..((((.((.........{{{,..,.......,,{,,,,,.,((((.((((((((((...{{{(,...}})).......((((((.....))))))))))))))))}}}),|||{||||.((((......)))),|||||.}}}.|,,,.....,}})}.,))),,}).))))..))))).))))).,))).))))).)))))))).)))).).))))))))))))))).)).((((..((((((((..(((((.((((((({((.({(((({{{...(((((((.(((((....,......,,.))))).)))))))....{{{,,((((((.(((((((...)))))))))))))}}}}},{{{,,,{,,,{,((((((((,,.,..,,((({((((.....}}}|||||.,,,{,...(((({{({{((......,)}}))}.}))}((((((((...))))))))........(((({{((((((,((((((......)))))).}}|},{({(((.(((({..{(,((,.,.}}.||||||}.|}||}}}||}}}}..,,,,,((((.((((((((.....))))))))))))..,{{,{,,({{{||,|||,..{{.{{..,,})}))},,)}},}}}}}}.,||}}}}}.,.,}}}}}})},})))}},,}||{{|,.|{|{|||||.,,||}|||||{,((({.....,,,,...........)))),)}}))))}}|...,,,,..,|,..(((((.,,)))))..}},}}}}}|||||{.,,(((((({({{{(.{((,.,||..,})).....}})}..},.,{{......}},,,},,,..,}))))))}}.,||||||.,,)))}))},.)))))}}.)))))})}),))))}})).)))))))))....))))..))))...((((((((...)))))))).)))))))).}..}..)))).....((((((((((((..................))))))....)))))).......}))))(((((((...)))))))..,((((((.((((......)))).))))))|{{{.....,||,,,,))}}}))))}),..,||||,,..,,,,,.,.{{{{{{{{{{..,,,.||{.((....||.|||{|,,,,|}}}}))))),||||,.{{{.....}}}.}}}))))).))))))))...,}))))))}}}(((((({,(((....((((((..((((((...((((....)))}}.)))))).....))))))..))))))))))........|((((.(({{,..{((((.((((..((({........((((((((....))))))))((((......((..(((.((((....)))))))...))....))))(((.(((((.{.(((.....))).).))))))))...})))..)))))))))}}.}).)))))))))))).))).))))).))))))))))))))))........})))))))))))))..))))).))))))).))))),))))),,{{,{,{{{.,{,,,.||||({,.,,,|,...|||||||||{((((....)))),((((((.....)))))),{{.|,..,}}|||,||||,}|},......,))))}}),......))).)))).}.)).))))))))))))))...)))))))))........}}}}........

Transcripts

ID Sequence Length GC content
GAAACACAGACUGGGAGCGGGCGGGAGCGGGAGCGCGGCGCACGCCCCG… 6464 nt 0.5114
Showing 11 to 11 of 11 entries
Summary

The SMAD family of proteins are a group of intracellular signal transducer proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. The SMAD3 protein functions in the transforming growth factor-beta signaling pathway, and transmits signals from the cell surface to the nucleus, regulating gene activity and cell proliferation. This protein forms a complex with other SMAD proteins and binds DNA, functioning both as a transcription factor and tumor suppressor. Mutations in this gene are associated with aneurysms-osteoarthritis syndrome and Loeys-Dietz Syndrome 3. [provided by RefSeq, May 2022] CIViC Summary for SMAD3 Gene

Forensic Context

A study in mice demonstrated that ethanol administration significantly upregulated the SMAD3 mRNA and protein expression, which was reversed by astaxanthin (AST) supplement [Liu et al. DOI:10.3390/Md17030181].