| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAAACACAGACUGGGAGCGGGCGGGAGCGGGAGCGCGGCGCACGCCCCG… | 6464 nt | 0.5114 |
The SMAD family of proteins are a group of intracellular signal transducer proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. The SMAD3 protein functions in the transforming growth factor-beta signaling pathway, and transmits signals from the cell surface to the nucleus, regulating gene activity and cell proliferation. This protein forms a complex with other SMAD proteins and binds DNA, functioning both as a transcription factor and tumor suppressor. Mutations in this gene are associated with aneurysms-osteoarthritis syndrome and Loeys-Dietz Syndrome 3. [provided by RefSeq, May 2022] CIViC Summary for SMAD3 Gene
A study in mice demonstrated that ethanol administration significantly upregulated the SMAD3 mRNA and protein expression, which was reversed by astaxanthin (AST) supplement [Liu et al. DOI:10.3390/Md17030181].