Basic Information

Symbol
SMAD6
RNA class
mRNA
Alias
SMAD Family Member 6 HsT17432 MADH6 Mothers Against Decapentaplegic Homolog 6 MAD Homolog 6 MADH7 MAD, Mothers Against Decapentaplegic Homolog 6 (Drosophila) Mothers Against Decapentaplegic, Drosophila, Homolog Of, 6 SMAD, Mothers Against DPP Homolog 6 (Drosophila) SMAD, Mothers Against DPP Homolog 6 Mothers Against DPP Homolog 6 SMAD 6 HSMAD6 AOVD2 Smad6
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_005585.5
Sequence length
3828.0 nt
GC content
0.5880

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1610.80 kcal/mol
Thermodynamic ensemble
Free energy: -1676.05 kcal/mol
Frequency: 0.0000
Diversity: 861.69
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......((((..(((((..........((((((((..((.(((((((.((.(((.((((((((((.(((((.....((..(((..(((((.(.(((((((((((.(((((((.(((((((((((.....(((((((..(((((((..(((...((((.((((.....((((((((((((....(((....))).(((((((.(((((((((.(((((((..(((((((((.....))).))))))...((((((((((((.((((((....((((.(((((((((..........(((((((.(((((.......)))))))))))))))..)))))).)))))))).)))))))(((((((..........((((.((((.....)))).)))).)))).)))(((....)))((((.((((.(...((((((((...(((((((.(((.((.((((((.(((((((((((((((................)))))..))))))))))..)))))).))))))))))))))))..)))).))))).))))..)))))))........((((((.(((......))).))))))....(((((((......(((((((..((((((((((.((((.((...(.(((((((((((((((.((((.....((..((((....)))))))))).)))......(((((((.((.((((.(((((((((......).)))))))).)).......)).))..))))))).))))))))).))))(((((..(((((((.((.((......)))).)))))))..)))))......)))))))))))).)))).))).)))))))))))((((((............(((((((((.((((.(((....((((((((((...)))....)))))))))))))))))))))))))))))..)))))))..........((((...))))....))))))))).)).)))))..((((((((....((((((...(((.(((........))).)))))))))...))))))))...))).)))).))))).))))))))..)))))))))).)))))))((((((((......((((.((.(((((.(.(((((.((((((..(((((((((((.......((((((((((....))).........)))))))......))))))).)))).((((..(((((((..((((((((((((...(((((......))))))))))((((((((((((.((.(((((.((.......)).)))))..))..))).))))))))).(((((((((((.(((....))).(((((.....))))).((((..((((((((((((.....))))))))..((((((((((.(.(((((.(((((((..((.((((((.((..(((.((((((((((...)))))..))))).)))..)).)))...))).))..))))))).)))))).))))).)))))))))..))))....))))))))).))((((.....))))((((...)))).)))))))..).)))))).(((((((((.((.....((((((((.(((..((((((.(((.(((((((((..(((........)))...))).)))))).)))))))))))))))))))))).)))))))))........))))...((((((((((.((((.((((..((...((.(((((.((....))...)))))))..))...)))).)))).))))))))))...........))))))))))).).)))))))..))))))))))))......))))))))).....((((...))))....((((.(((..(((((..(((........)))..)))..))..))).))))..)).))))))))))...))))).((((..(((((((((((((((.(((..((((..(((........).))..)))).))))).)))))).))))))))))).((((.((.((((((((......)))))......))).)))))).(((((((((((((((......(((((.((((((...(((.((((..((((......)))).(((((((((((((((((.(((....))).)))...))))))).(((.((((((...)).))))))).((.((.((((..(((.........)))..)))).)).))...(((........)))))))..)))))))))))))))))))))))))))).).)))))))))))))))).)))..))....)))))..))))))))((((((((..((.....)))))))))).....))))).)).)))))))..)).......)))).)))).........((((((((.(((((((..((...(((..((((........(((((((((...((((...((((...)))).........(((.....)))))))...)))))))))(((((((((..(((....)))....)))))))))((((((....))))))..))))..))).))..))))))).((........)).........((((....)))).(((((((...((((((((...))))))))...)))))))(((((((((..(((....)))..)))))).)))...(((((((((((((.....((((((...((.......))......))))))((((((((((((((((......(((((.......)))((((...(((((((((....(((((((((((........((((...((((((.(((((.((((.((((((......)))))).)))).))))).))))))...)))).................((.(((((..(((....)))......))))).))...(((((((.....)))))))...(((((((((((((((((((((.((((...(((((((((((((.....(((.......))).((((..((((..((((((((((((.((((........))))..)))))...)))))))..)))).))))....((((((....)))))).))))))....))))))).)))).)))))))..(((((.(((.((((((..(((((..((((((((((............)))).)))))))))))))))))(.((((((((......)))))))).).....))))))))....((((((((((((..((..((((((((((.((((.......)))).))))).....(((((((.(((......))))))))))..)))))..))..))))....))))))))........((((......)))).(((((((((...(((.((((((((......((....))...((((((((................))))))))........((((.....)))).........))))))))....))))))))))))....)).)))))))))))))))))).)))))....)))))).....((((((..((....))..)))))))))..)))))).....))))))))))).))))))))))).)).)))))..(((((((...................))))))).)))))))).((((((...(.((((....................(((((((((((((((...........))))).)))))))))))))).)...))))))...))))).............))))......
Thermodynamic Ensemble Prediction
......{(((,{(((((.,,{{,{,,|(((({(((,,,,.((((({{.{{.(((.((({{{((((,((({{....,(({,((({{(((((.{{((((,((,(((.(((((((.(((((((((((...,.(((((({,.(((((((..(((...((((.((((.....,(((((((((({....(((....))).(((((((.(((((((((.(((((((.{(((((((((.....))).))))))||.((((((((((((.((((((....((((.(((((({{(,.........((((((,{(((((.......))))))))))))})),.)))))).)))))))).)))))))(((((((.,....,,..((((.((((.....)))).)))).)))).)))(((....)))((((.((((.(...((((,(((...((((((((((({({.((((((.(((((((((((((((................))))),.})))))))))..)))))).))))))))))))}))),.)))),,)))).))))..))))))).,,.....((((((.(((......))).))))))....(((((((......(((((((..{(((((((((.((((.((...(.(((((((((((((((.,,({.....}|..||||....{{{{{..,.,))))}....,(((((,(,(({({((.(((((((((......).)))))))).))..,....)).)).})))))}}.})))))))).)))}|{((({{(((((((.((.((......)))).))))))}..}))))},....)))))))))))),))}}.))),}))))))))))((((((............(((((((((.((((.(((....((((((({.||,.}},,,.})))))))))))))))))))))))))))))..)))))))........,.((((...)))).,..))))))))).)).)))))..((((((((....(((({,..{(((.(((........))).))))})))),},))))))))...})).))))}))),).))))))))..)))))))))).)))))))((((((((....,{((,(.((.(((((.(.(((((.((((({..((((((((((({......(((((((,((,.{{|,,...}}}.,})))))))..,.}}))))))).)))).((((.,(((((((..((((((((((((,..(((((.,,...}}}))}))))(({(((((((((,{{.(((((.{{.....,,),,)))))..)),.))).))))))))).{,(((((((((.(((....))).(((((.....))))).((((..((((((((((((.....))))))))..((((((((((.{.(((((.(((((((..((.((((((.((..(((.({((((|(({...)))))}.})))).))),.)).)))|..|)).))..))))))).)))))).))))).))))}))))..))))....))))))))).},((((.....))))||{{..,)))),)))))))..).)))))).(((((((((.(({,...{(((((((.(((.,((((((.(((.(((((((((.,{|(|,|.....,))..})))))))))).)))))))))))))))))))))).)))))))))......,,))))...((((((((((.((((.((((..(,...,(.(((((.((....))...))})))),.),}..)))).)))).))))))))))...........})))))))))).).))))))).}.)))))))))))....,.)))))))))(({{{(({{...,|||.||,({{{.{((,,((,{{..||{.,,....,))),,}}}.,))..})),)))}..)).)))))))))).}},))))}((((..{((((((((((((((.,(((....)))({(((({.{,...))..,)))))).)).)))))).))))))})))),((((,((,((((((((..,...|||||,,.,,.}}},||||}}.(((((((((((((((......(((((.((((((..,(((.((((..((((......)))).((((((({,((((((((.(((....))).))}...,||}|}{((({.((((((...)),})))}})})}.|{}|{(({{,,,.....}}}}|||{{|,,,.,,..,,}}|||......}})))))))..)))))))))))))))))))))))))))).).))))))),,,,))))).}}}..}}....}||||,.}}})))}}((((((((..({.....)})))))))).}}))))))).)).))))))}.,}........}))),))||,,,{,,...(((,,{||}(((((((..((...(((..((((........(((((((((.,.((((,{,((((...}}}).........{{|.....)))}))}...)))))))))(((((((((,.(((....)))..,.)))))))))((((((....))))))},))))..))).))..))))))).((.......,},..,,,,...||||....}}}|.(((((((...{{{(((({..,}}}}}}}}.|,))))}||{({((((((..(((....)))..)))))),))},,.,,,|||||{||||}}...((((((.,.((.......}}......)))))|{|||||{{((({{(((........|||......,}}}}|||||,,,,{{{{{{....{{{{{{((((({{{{....||||}},{(((((.(((((.((((.((((((......)))))).)))).))))).)))))},,,|||,.,{{{,.,,{,,.....((.{{{{(.,(,,.,,,|||......}}}}}.))...(((((((.....))))))).{{(((((((((((((((((((((.((((...(((((((((((((.....,{{.......||,.((((..((((..((((((((((((.{(((,,.....,))))..)))))...)))))))..)))).))))....{(((((....)))))}.))))))....))))))).}))).)))))))..((((,.((((((((((..(((((..((((((((((............)))),})))))))))))))))|{.((((((((......)))))))).},...|))))))))....{(((((((((((..((..(((({(((({.((((.......)))).})))).....(((((((.(((......))))))))))..}))))..))..))))....)))))))}........((((......)))).(((((((((...(((.((((((((.,,...({....))...(((({(({....,......}....}}}))))}....,,,.((((.....)))).,.,,,...))))))))....))))))))))))....)).))))))))))))))}}})}}))))..,,)))))),....(((({({,((..,,}},,}}}))},||,,}}},,|{,,,.}}}}})))))).))}))))}},}||,},,}}}..{((((((|,,{{....}}},......))))))},|||||||,.,,,,,.}}}|}||||,|||,,},,.}}},}},...{(((((((((((((({{{....,}},))))).))))))))))}}}}}}}}})}}))},..))))),|,......,.},))),......

Transcripts

ID Sequence Length GC content
AUAUGAUGGGAGGCAGCCAAUGACUCCGCGGCGCUCCUCCGGGGGCCCU… 3828 nt 0.5880
Summary

The protein encoded by this gene belongs to the SMAD family of proteins, which are related to Drosophila 'mothers against decapentaplegic' (Mad) and C. elegans Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein functions in the negative regulation of BMP and TGF-beta/activin-signalling. Multiple transcript variants have been found for this gene.[provided by RefSeq, Sep 2014]

Forensic Context

A study in human ischemic cardiomyopathy (ICM) patients demonstrated that the SMAD6 gene, an anti-inflammatory negative regulator of BMP and TGF-b signaling, was decreased in the arterial endothelial cell population in ICM hearts compared to non-failing controls [Simonson et al. DOI:10.1016/j.celrep.2023.112086].