| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUAUGAUGGGAGGCAGCCAAUGACUCCGCGGCGCUCCUCCGGGGGCCCU… | 3828 nt | 0.5880 |
The protein encoded by this gene belongs to the SMAD family of proteins, which are related to Drosophila 'mothers against decapentaplegic' (Mad) and C. elegans Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein functions in the negative regulation of BMP and TGF-beta/activin-signalling. Multiple transcript variants have been found for this gene.[provided by RefSeq, Sep 2014]
A study in human ischemic cardiomyopathy (ICM) patients demonstrated that the SMAD6 gene, an anti-inflammatory negative regulator of BMP and TGF-b signaling, was decreased in the arterial endothelial cell population in ICM hearts compared to non-failing controls [Simonson et al. DOI:10.1016/j.celrep.2023.112086].