Basic Information

Symbol
BAIAP2L1
RNA class
mRNA
Alias
BAR/IMD Domain Containing Adaptor Protein 2 Like 1 IRTKS Insulin Receptor Tyrosine Kinase Substrate Brain-Specific Angiogenesis Inhibitor 1-Associated Protein 2-Like Protein 1 BAR/IMD Domain-Containing Adapter Protein 2-Like 1 BAI1-Associated Protein 2-Like Protein 1 BAI1 Associated Protein 2 Like 1
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Other applications

MANE select

Transcript ID
NM_018842.5
Sequence length
3645.0 nt
GC content
0.5166

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1231.30 kcal/mol
Thermodynamic ensemble
Free energy: -1295.33 kcal/mol
Frequency: 0.0000
Diversity: 931.50
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((((.(((.((((((.((.((........)).))))))..)).)))))))))))(((((((((........((.(((....)))))((((((((.(((((((((((((((((....)))))))..(((((..(((((((.(((.(((((((.(((.((((.((((((((.....(((((((....))))..)))((((......)))).(((((..(((..(((((....(((.((((((....))).))).)))...)))))..))).)))))(((..(((((((((..(((....(((...(((((((((.(.............(((((((..((((((((....(((.((((..(((.(((((((((((.....((((.....((.(((((((.....(((((((((.....(((.(((...))))))((((((.(.((((((..(.((((((((...((.((((((...(((((((..(((.....)))))))).))..((((((...............)))))).((((.....))))............)))))).))......))))).....(((((((.............................)))))))....))).)..)))).)).).))))))....(((((...((..(((((.((((.........(((((.....................(((((.(.((((.....((((((.......))))))..)))).).)))))((((((....)))))).(((((...(((((..(((...((..(.((((((...(((..((((((....(((((.........))))).......))))))....)))...)))))))..))...)))))))).)))))(((((((...(((....)))..)))))))..)))))........(((((....)))))................((((.(...........).))))...))))..)))))..))..)))))(((((......(((((((......))))))).....)))))......))))))...))).....))))))).))))))((((((((.((..((((((((.((...(((((((......((((....)))).(((...........)))..............((.....)).....((((.(((....((((((......))))))))))))).)))))))(((((....((((...((((.(((.(((((((.(((..(((.(((((......)).)))....)))...)))...)))))))))).)))).))))))))).((........)).((((((.......((((((.((..(((((....(((((.(((......))).)))))..)))))..))....(((((((((((((((((..((.(((...((((((((................))).)..))))...))).))....)))))).......((((..((((((.......((((((((((.((((..(((.((((....))))))).....(((((.(((((((((..((((((.((((((.........((((((((..(......(((..(((((((((.....(((..((..((((((..((((((.....(((((((....)))))))...))))))....(((......))).(((..(((((....).)))))))((.((((((((((..((((.(((.((((.(((.(((....))))))....)))).)))))))..)))))))))).)).))))))..))..))))))).))))))))......)..)))...))))).......)))))))))).....)).)))).))))).))))))))).))))))))))))))))....)))).((((((.....(((((....(((....)))..)))))....)))))).))))))))))).((((..((.(((((((((((((.(((....)))..)))))))).))))).))..)))).)))))).......)))))))).)))))))).)).)))))))).((((((((.((((................))))))))))))........((((.(.(((.(((((..(((((((((((.....)))))).......((((((((......))))))))((((((((..........))))))))(((.(((.........))).))).......)))))))))).))).)))))((((((((((((((((((...((((..(((((....((((((((..((.(((((((...(((...((.(((.........))).))..)))))))))).))((..((((....))))..)).....((((((((((..((((.((((((((((..((((....))))..))))((((((((((((..(((......)))..))))...))))))))..........))))))....((((..........))))..)))).)))))).))))((((((((((..((((((((......(((....)))......))))))).)..))))))))))...))))))))..))))).)))).)))))))))......(((((((.(.((((((((.(.((..(((....)))..)).).))))).....)))))))))))((..((((...))))))....)))))))))))))).)))))))))......)))).)))......))))))))....)))))))).)))))))))...)))..))).)))))))))..)))))).))))).))))...((((....)))).((((....................))))......))).).)))))).))).))).))))..)).)))................(((((((((((((((..((((((((......(((.(((((((((((((((((.((.(((...))).)).)))))..))))))).((((((((.((((.((((....((((((.........((((....))))))))))))))..)))).)))))))))))))...)))...((((.(.((((((....)).)))).).))))..((((((((((((((....)).)))))...(((((.........)))))((((((..((.....))((((((((....((((...))))........(((..(((((...)))))..)))))))))))((.(((....)))))((((....((((((..((...(((((((......((((..((((((...))))))....)))).....))))))).))))))))))))((((((...((((...(((.((((......)))).)))...)))).))))))))))))........)))))))((((((((((.......))).))))))).)))))))).)))))......)))))))))).((((((..((....))..)))))).))))).)))))))))))))..((((...(((....))))))).(((((....))))))))))))))......
Thermodynamic Ensemble Prediction
...{(((((((.(((.(((((({(,.((........))}))))))..)).))))))))))}(((((((((........((.(((....)))))((((((((.(((((((((((((((((....)))))))..(((((..(((((((.(((.(((((((.(((.((((.((((((((.....(((((((....))))..)))((((......)))).(((((..(((..(((((....(((.((((((....))).))).)))...)))))..))).)))))(((.,(((((((({..(({....(((...(((((((((.(.............(((((((..((((((((....(((.((((.,(((.(((((((((((...,{((((((,.,({,({((((((...{(((,,.,,|}}}}}}}}}{((,,.|}}|{,((,,{,.|.|{|||||.{,{,(((.,,{{{,{{({,.{{...,|{{{||.,(((...,,)||||||}.||..,{{{{....,}}}}...,,..}|||||.||{,,,.,{|||}....,,,.,...,|||{,(((,,......,,.}}}},{((((({.............................})))))){{{{||,....|||,,.,{{{|,||,.....|,|||}..||}.,,,||}||||.((.....{||{((((,...,.............}}||||.|}||{{,..,,({{({{{{|.,{,|}||}}..}}}}.|.,|||,((((({....}))))}.|||(({{{((({{,,{{{,,{(({{({((((((...(((,,((((((....(((((.,,....,.))))).......)))}}}....}))...))))),...}}...,,,,,}}}.}}}})(((((({,..(({..,,)}),,)))))))..,|||{({{{,,..(((((....)))))............,,..{{{{,{||,.....,||,|}})).,||||,{.}||||{.|,,.,,,,,|.|.|}}}}..|{{|{{,.{{{{{{..,,.,.....}))))}..,|{|||.||.,,|},{{...,,})}})})},))}|||||||,.,,{{((((((((.{{,..,{{{{,.......((((....)))).(((...........)))........,,....{{..,..||,,{{{{{{{.{{{....|{||||...,||)),,}},}}))))))),.,.,{{{{|...{((((...((((.(({,(((((((.(((.,(((.((({(,.....,),))}....))).,.)))...)))))))))).)))).))))))})},{{,.,,,}..)),||{|{{,,,,|.,{{{{{,,((..(((((....(((((.(((......))).)))))..)))))..)},,..(((((((((({{({(({..{{.(({,,.((((.{{{{{.......{,{....))).}..))}}..,))).))...,}}}))).......((((..((((((.......((((((((((.((({,,(({{((((....)))))))..,,,{{{(({(((((((((..((((((.((((((...,,,...|||(({,.{{{{{..{(((({.,.,||,|||}....,,|}}|}..,,|||,.,{({{{{..{..{((((((....))))))}...)))))|{{{|{,{,,.,,..,((((({{(({(({,..,.}))}}}}((.((((((((((..((((.(((.((((.(((.(((....))))))....)))).)))))))..)))))))))).)).,,,}||,.||..,}}))})})))))))).,}.},}}))))||{|}},,..},,,.)))))))))).....)).)))).))))),))))))))).))))))))))))))))....)))).|{{,(({{...(((((....(((....)))..)))))...,))),},.})))))))))).,(((,.{{.{{({{((((((((.{((....)))..)))))))).}))}}.,}..)))}.}))))).}.....})})))),.,}}))))).))})}||)}}|}{{({(((({{{{{..,,..,,,...}...}})}))}}))}|{{,,,.,,}}||||(((((......))))}.|||{{{.....)))))},}}}}..{(((((((......)))))))|((((((((..........))))))))},,.{{{.........))}.,},.(((((({...})))))))))),)))){(((({((({{(((((((...((((..(((((....((((((((.,((.(((((((,..,((.,.((.{((.........))),}}..)))))))))).})|....{{{((((((({(,,,,...,|||||.||..}}}}}|.((((((((((..((((....))))..))))(((((((((({(.{(((......))).})))},}}))))))))..........))))))....||||..........||||........))))))})))|(((((((((..((((((((.....,(({....))).,....))))))).)..)))))))))}...))))))))..))))).)))).))))})|||{{{,..(((((((.(.((((((((.(.((..(((....)))..)).).))))).....)))}))))))),{{{.,..,))))))))....))))))))))))))}})))))))).,....)))).)))......))))))))....)))))))}.)))))))))...,})}.)}),))))))))).,)))))).))))).)))).{{((((..,.}||}.,,,|,,.,,..............,,},)}})}).))).).)))))).))).))).))))..)).)))..........,.....(((((((((((((((..((((((({......(({,{{|||((((((((((((.((.(((...))).)).)))))),,}))))}.((((((((.((((.((((....(((((,..{{{,.{.{,.....,,)))))))))))))..)))).)))))))),))}|{,.|||,..((((.(.((((((....)).)))).).)))).,((((((((((((((....)).))))),,,((({(...,{,{{{|||||{((((({.((,.,.,||((((((((....{{{,...,}})........(((..(((((...)))))..))))))))))).,.{{{....|||,{((((,,..{((((,.{((...(((((((......((((..((((((...))))))....)))).....))))))).)))))))))))}|||||,,|,,{{{|,.(((,...,))).,}))),))).}}})))},}))).)}))),),,......)))))))((((((((((.......))).))))))).)))))))).)))))......)))))))))).((((((..((....))..)))))).))))).)))))))))))))..((((,..,{{....}}))))}.(((((....))))))))))))))......

Transcripts

ID Sequence Length GC content
CUCUGGCGGCGUCCGGCCGCUUCUCCUCUGCUCCUCGAAGAAGGCCAGG… 3645 nt 0.5166
Summary

This gene encodes a member of the IMD (IRSp53/MIM homology domain) family. Members of this family can be subdivided in two groups, the IRSp53-like and MIM-like, based on the presence or absence of the SH3 (Src homology 3) domain. The protein encoded by this gene contains a conserved IMD, also known as F-actin bundling domain, at the N-terminus, and a canonical SH3 domain near the C-terminus, so it belongs to the IRSp53-like group. This protein is the substrate for insulin receptor tyrosine kinase and binds to the small GTPase Rac. It is involved in signal transduction pathways that link deformation of the plasma membrane and remodeling of the actin cytoskeleton. It also promotes actin assembly and membrane protrusions when overexpressed in mammalian cells, and is essential to the formation of a potent actin assembly complex during EHEC (Enterohemorrhagic Escherichia coli) pedestal formation. [provided by RefSeq, Oct 2009]

Forensic Context

A study in mice demonstrated that the BAIAP2L1 was the most downregulated gene (0.260-fold reduction) in lung tissue following hypothermia-induced death, identifying it as a candidate forensic biomarker for hypothermia [Takamiya et al. DOI:10.1016/J.Legalmed.2020.101789]. In a separate investigation using a perinatal glyphosate exposure mouse model, the BAIAP2L1 was identified as a top upregulated mRNA (22.50-fold increase) in hippocampal tissue, suggesting its potential as a biomarker for glyphosate-induced neurotoxicity [Xingli Fan et al. DOI:10.1002/jdn.10102].