Basic Information

Symbol
SMARCA5
RNA class
mRNA
Alias
SNF2 Related Chromatin Remodeling ATPase 5 HSNF2H HISWI ISWI SWI/SNF Related, Matrix Associated, Actin Dependent Regulator Of Chromatin, Subfamily A, Member 5 SWI/SNF-Related Matrix-Associated Actin-Dependent Regulator Of Chromatin Subfamily A Member 5 SWI/SNF-Related Matrix-Associated Actin-Dependent Regulator Of Chromatin A5 Sucrose Nonfermenting Protein 2 Homolog WCRF135 SNF2H Sucrose Nonfermenting-Like 5 EC 3.6.4.- EC 3.6.1
Location (GRCh38)
Forensic tag(s)
Chronological age estimation

MANE select

Transcript ID
NM_003601.4
Sequence length
7684.0 nt
GC content
0.3837

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1999.6 kcal/mol
Thermodynamic ensemble
Free energy: -2150.27 kcal/mol
Frequency: 0.0000
Diversity: 2256.07
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.(((......((((...((((...........(((((((((.((((.((((.((((((.......))))))(((.(((((((.((.(..((((((.((((((((((((((...))))..))))).......(((......))).....(((.((((((....((((.........))))..))))))..))).((.((((((((((..((.......)).)))))))))).))))))))))).))..)))))))))))))))))))))))))))))))))).).))).....))).))))(((((((((((((((.......(((((((....)).)))))((((((((((....))))))).))).((((((......))).)))...((.(((((((((...((((((.(((((..(((....(((((((.(..((..........(((...(((((.....................((((((((((((((.((((.........(((((.(((........................))))))))..........((.(((((....))))).))(((((((((.(((((.((((.......((((..(((.....)))..)))).(((((......)))))..............((((((((((((((((((((...........(((....))).......(((((..((((((((((.(((((((.(((.(((.....))).))).....))))).)).)))))).))))...))))).(((((((((((((((..(((.(((.((....)).))).)))))))).))))))))))......)).)))))))......))))))))))).......................)))).))))))))...))))))((((.((((..(((............(((((......))))))))..)))).))))..)))).))))))))))))))))))).)))..........))..).)))))))))).))))).))))))...((((.(((((((((.......))))))))).......((((((..(((.....(((.(((((.........))))).))))))..))))))..(((((((.((((((((((...........(((((((((.(((.....((((...((((((.(((....))).)).........))))...))))))).).))))))))(((..((((....(((.(((((((.....))))..))).))).......))))..)))..))))).)))))(((((...))))).((((((..(((((.(((((.(((((.((((((((((((..(((((((.((((((.(((((((.((.((((...((((...((((((...(((((((((((......)))........((((((((..(((..(((...)))..)))..........(((((.(((...(((((.(((((((..((((((..((((((((((((((.......(((.(((..((((.(((((...((((((..........(((((((..(((((((...(((((((((((((...((((.(((((.......((((((....)))).))..(((....)))......)))))..)))).....)))))))....)))))).((((...))))....(((.((((((((....(((((.(((.....)))..)))))..)))))))).))))))))))...)))))))..))))))....))))).))))..))).)))((((.(((......))))))).((((...(((.((.(((..((((((...((.(((((.......))))).)))))))).))))))))))))..)))))))..))))))))).))))..)))))))...((((.((((.....)))).)))).)))))....)))..)))))))))))))....))))))))....((((.((((((...))))))...)))).....(((((..........))))).....((.(((((......)))))))....)))))))))))))).)).)))))))...)))))))))))))...........((((.........(((((((..((......))))))))).....(((((((((((((......((((....))))..))))).((((((((((((.((((.......((((........))))(((.(((((.....((((........))))....))))))))....((((.((..((....))..)).)))).((((((.((((......))))..))))))...........((......))..((.((((......))))))................))))..))))))))))))......((.((((.((.(((.(((((((.....)))..))))..))))))))).))........(((......)))((((((((((...((((((..((((.((...........)))))).)))))).((((((...))))))........((((((...)))))).))))))))))(((((.....))))).))))))))..........((((((..........))))))..))))......)))))).((((((((...........))))))))...((......))((((((..(((((....))))).))))))....(((((((..(((((((((((..(((((.(((((...)))))................(((....((.((((((..((((((((....))).((((((((((((...(......)...).))))))))))).........(((((..((((((((((.....((((...(((((....(((((.(((...((((((((.(((......))).......(((.......)))(((((..(((.(((((...(((.(((((((((.(((((((((...(((...(((((....((((((.....)))))).....)))))......((((((((....(((((..(((.....(((((((.((.(((((....)).))).))..))))))).....)))...)))))))))))))((((((((((((((((((...))))..(((((......))))).....(((((((((......((((((((.(......(..((((((........................))))))..)........(((((.(((((((...((((((((.((...((((......(((((.(((((.........))))).))))).................(((.((((.........)))).)))))))...(((((.((...(((((.....)))))...)))))))...))))))))))))))))))))))...((((......)))).).)))))))))))))))))......((((...))))..........((((..(((((((..(((((((((..........)))))))))))))))).....))))......)))))))))))))).....((((((((((.(((....((((.(((.((.....(((((..((((((...........)))))).....)))))...)).)))))))...))).....))))))))))......(((.(((((...))))))))(((((....)))))....)))...))))))))))))))))))))).))))).))))))))..........((.((((((.(((((....))))).)))))).))..((((((((.((((((((((.(...........).)))))).)))).))))))))))))))))..))).)))))....))))).))))((((((((....))))))))))))))))))....)))))..((((...(((((((.(((((((((((((((((....))))).))......))))))).........((((....))))....))).))))))).))))..))))))))))).))..)))...(((((((.....((((((.(((((.((.....)).))))).))))))..(((((((((((..(((((((((.....))))))((((((..........))))))...........)))...))))).))....))))........((((((........))))))....)))))))(((((.....)))))......((((((((((((((.....))))))).......))))))).....((((((((((((..((((((.((((((.(((........)))...(((.((((((((((((((.....(((((((((((..........))))))))))))))))))))((((((.(((((((((((((((((((((..........)))).(((((((((..........(((((.....((((((..........)))))).....)))))..........)))))))))....))))))))))..(((((((....((((..(((((((((((....(((((....((((.((....)).))))((((((....((.((((.((((((......)))))).....((((((((...))))))))......)))).))))))))...((((((.(((..(((...))).)))))))))....(((((.....((((....)))).......)))))((((.....(((((((((((((.((.(((((((((.((((...)))).)))))))))....((((((.........)))))).........)).))))).)))))))).....(((((((.....)))))))......(((((...........)))))(((.(((((....))))).)))....)))).)))))....))).))))))))..)))))))))))........((((.......))))((((((((....)))))).)).)))))))))))))((((.(.....)))))..........(((........)))))))))))....))))))))))))....))))......))))))))....)))))..)))...)))))))))))))))))))))..))).)).))))).)))))))))))...............((((((...(((......))).))))))...((((..((((((((((((((..((.....)).))))......))))..)))))).)))).......((((.(((......)))))))..)))))))...))))...)))))))))..))((((((.((((((.(((.(((.....))).))).......(((.((((.(((...................))).)))).)))..............(((((((..(((((..(((...................(((((........))))).(((((..((((..........))))..)))))((((.........))))..((((....(((((.((...)).)))))..)))))))..)))))..)))))))..)))))).))))))))))))).)))))..............(((((.(((...(((((((...((.....((((((((((.((((..(((((........)))))..))))............(((((((((........(((((((((...)))).))))).....((((((((...))))))))......(((((((((((((((.((.......)))))))))..((((((.((((.((.((((......(((((((....((((((...((.(((((((.(((((((..........(((((((....)))))))))))))).....((((((....((((((((.((((((((((.....(((.......)))..((.((((((.((((............((((((((((((((.(....((((((((((..((((((((((......((((.(((............))).))))..(((((((((.((....)).)))))))))))))).)))))(((((((.((((.(((((((((((((.........((((((((((((((.((.((((..(....)..))))))))))))))))))))..))))))))))))).)))).....(((...)))..)))))))...(((((((....((((..........)))))))))))....(((((..(((....))))))))..(((((.((..(((((...(((...(((((((((((((.(((((((...((((((((....))))))))..)))))..)).))))(((((((((((..((((.........((((........(((....)))....(((((((...)))))))...................((((((((.((..................((((((....))))))..((((((............))))))...)).)))))))).)))).......))))...))))))))))).))))))))).))).)))))..)).)))))((((((.(((....))).))))))......))))))).))).).))))))).((((((.....)))))).......(((((((.....)))))))(((((((((...(((((((((((((.((((((((((...(((((..(((...........((((((...)))))))))..)))))))))))))))))))))).))))))((.(((...))).))(((.....)))))))))))))))))))(((((((((((((((....))))).....)))))))))).....((.(((((.(((((...((((.(...........).))))...))))).))))).))....)))).)))))).))...))))))...........((((..((.......))..))))(((((........)))))........(((((((....))))))).((.(((......))).))...((((...)))).))))))))))))))))))....((((((....(((((......)))))..)))))).....)))))))))...)).))))....)))))))...)))).))....)))).))))))....((((....))))...))))..))))(((((.(((((((((((((((....)))))..............)))))))))).)))))))))))))))))))))))).....))..)))))))..))))))))..(((((((..((((((((((((.....)))))))..........)))))...))))))).....(((.......)))((((..(((((((....)))))))..))))....(((((.......(((((.((((.....)))).))))))))))..........(((((((.......)))))))((((((.........)))))))))..
Thermodynamic Ensemble Prediction
((((.(((......((({...((((...........(((((((((.((((.((((.{(((((.......)))))}(((.(((((((.((.(..({((((.((((((((((((((...))))}.,)))).......(((......))).....(((.((((((....((((.........))))..))))))..))).((.((((((((((..({.,.....,,.}))))))))).))))))))))).)}.,}))))))))))))))))))))))))))))))))).},})).....))).))))((((((((((((((((,,,,,,((((({{,...||{|||||(({(((((((,..,||||||||{|{{,,..)))},))))})))))}..,,{(((((,......(((((...})))}.{(((,.,{{...{((,..,|,.....,,,|,|}||.,{{,,,,{{......,,{,..{{{{|||||{{(({(((({,{,{{|}|,,,,..,((((,{,{,....}}}}}......{{(((((((((({(((((.,,..(((({.(((((....))))).,|{((((((((.(((((.((((.......((((,,{{{.....))).|}}}}.(((((......)))))...,,.........((((((((((((((((((((.,,........{{{....}||,......|||||,.((((((((((.(((((((.(((.(((.....))).))).....))))).)).))))))},)))...,,,,|,((((((((((((((({.(,(.(((.((....)).))),),)))))).)))))))))).,}...)).)))))))......))))))))))).,,..,,,.....,,........)))).))))))))...)))))}|(((.((((..(((...,{.({(.......,..))),,,...)))..)))).)))}..{{{{{{,|||,{(({{((,.{{,,,,.},..}}}}},,((((.(((,,(({(.{(({{.,.,,...{(((((...(((((((((.......)))))))))....{(((({(((((((({.{{{((({(((..........{{{,(({{{{{{,,,{,,,,{{({{(((({{,,{,,(({....,|,....,,{((((((((.(((.....((((...(((,,{.,,,....||,.,},,,..,..})}))...))))))).),,))))))|{{|}}|||{|||||.((((((((((.(((((((...{{,.....,.,,,)))))))....((((((((((((({((.......)},..)))..)))))))))}....})))))))))||||||||||||||||,||{{{{{{{{{{{{{{.,..,..{((((,({((,....{{(,(((((,(((......))).)))))..}))})}),)))}},,||...,))}..,}}}},}})}}}.)}),}}|,,.,,},,,)}||}}}||}.,.(((((((,,(((.,...((((..(({.{,...,,}.)))..)))),...)))}))))))...{{{.{{....)}..}}}.)))))))))}|||))|...)))))){((((.......,,((({....}))).)},.(({....}))......)))))}})}.))}}})).)))),}}}})),....{|||...))}}{((.(((.((((((((....(((((.(((.....)))..)))))..)))))))).))).)))))))...,..))))))..))))))))))))}}}}}........(((((.(((......)))))))}.,{(.{((((((({(((..((((((...((.(((((.......))))).)))))))).)))}.|(((((.,,{{{.|||,(((((....)))))....})))).}}}((({.((((.....)))).}))}((((((({.,.((((((.,.,,|||,,...((((((((..(((((((({(({(((,,.,|||,,....}}}||,,{{{{{{{{{{,......,|||,,,.,,},|||{,......,||||{{{,((((((..((((.(((.....})),))))..))))))}}..})))}........((((((((((...(((((({..({......},))))))}....{((((({,.|{|.{(((((((((({,,,||,{{{,,{{({(({{,.,|||||,||{{,,{{{{,((((.......,}}}}(((.(((((.....((((........))))....))))}}}}.,,.{||||,{.,(((((,|,..,|...))||||||..{{{{....,,||||{(,{{{(((({{..,....,,{{{{{.||.,((,((((......}}}}}}....,.{,,{{,,,,(((,,(({({{,.{{{,((({({{{((,(((,{((,{{{.((((({(.....))}.,))))..}}))))))){||,,,({..,,{,......}|||{{||{((((,,,((((((..{{{{.{{......}}}..}})))).)}}}},.((((((...))))))........((((((...)))))},))}}}||||}||(((,....}}}}).,))),.............((((((........,.}))))),{(((((,,..,,,,..,.((((((((...........)))))))).,}||}}},..}},{((((..(((((....))))).))))))}}}}}..,,,...||{{{{|||||}}},,...,,,,|}},,}}}}.}||,|||,,}|||..|||....,{,{{{{,{.{(((((..{,,.{((..((((((((((((...(.,....}...}}))))))))))).))}.,}}}}}|}|,,(((((((((({..,.{((,...((((.....,||||..||.{{(((......}}}}}..,.,.,.,{{...{{{.,.....,))||||||||{,.((({{...{({.((((({((,,((((({{{,...{{{{{,{((({.{,,(((,{,,}}}}),,)))}},,.|||||,,,,..(((({(({,,,{{({{{,.,,,...{{,((,((((((........)))))).}|||,{((({{{|..,,|}}}}},,}}}))))))))}|{{{{(({{((({|((((...))))..(((((......))))).,{{.{((((((((......((((((((.(......{..((((((........................))))))..}........(({((((((((((...((((((({,((,{{{{{{......(((((.(((((.........))))).)))))...........,,....,((.((((.........)))).)})}}}}...{((((.((...(((((.....)))))...)))))))...))))))))))))))))))))))...((((......)))).).)))))))))))))))}}...},.((((...)))).......,,.{{{{..(((((((..{((((((((..........)))))))))))))))).....}))}.....,))))}))))))))),,,,,||||||{(({.(((....(({{{{({.((.,,..{((((..((((((...........)))))).....))))}.,.)).})}))))...)))..,,,))))))))}}..,,,,||{.{{{{{..,))))))))||||{...,)))),..,,}}})).))))))))))))))))))))).)))))})))}}.,,....,,...,((,((((({{(((({....||||}.}|||||,|}..((((((((.((((((((((.(.,,.....,,.).)))))).)))).))))))))||||.|{{{{{,...,,))}}}}.)))).}}))}|||||||,,..,}}}}}|||||||,,,,,{{{{{||,{{{(((({{.{{{((({.,,,((((((,..(((((....))))).........|||||||{.,,....}|,||,}},)},,....}||,}}|||||{|||}..||,|||{((((,.|,,,.,.,..,,,,|....,,}}}}|,.,.}||},}}....,,,{{{,,.,,,|}}}}|.,,,{{{{{{,{(,(((((((.....))))))|,{{{|,},....,}})),)))}}}},,..,,||||,....,)).,{((((((((.,{,{{{,,,||||,,....,,}},}||,{|||||,,|,{{{{|..|,,||||}|,|,.{((((((((((((((.....))))))).......))))))),}}}}}}}},.)))},,..,.,})),,))))))),,..,)}}.))))))),))))))}{(((((((((.....(((((((((((..........))))))))))))))))))))}.,,,,))))))}},}})))))))}}}}}}}..}))),)}}}}|,,.|||||,,,.,,,})}}}..}}})}},}))))}))}}))))))}}}}}))}}|,,|)))})))),,}},,,,})))))},})))))}})))))))}.,,({......)),}))))))))).....,}}}}},,}}}.}}))))))..)))))))),,,||...|,{{{(((({{{,,..,||||||||.....((((((((...)))))))),,{{{{(({,....,{{||||,((((((.{{,..,{{..,))).,,))))|||,|,.,.,{{{{{{{...,,|}}}}}},,.,.}}}}}}...}}}}}}}},,,}})})}}}}.}}.(((((((((,(({,....}}),))))))))){{.{(,(((({..{{{{.,||||||,{,..........}))}}}})))),)}},}}}}}}},}}.},,))))))}.....,(((((..,.....,..)))))|((.(((((....))))).))}.|{.({((,(((((((((.(((((.(((.....(((((....(({.......{(.((((((((((((((...((((((((((((,.......((((((({.((((((((((...,{.,{{{{{....,{,,{({...,(((.((((..{,(({....)})}..)))).))))}}.....,,,)))),,..,),...)))))).))))......)).)))))..,,)).)))))))))}{{..,(((((((..,..........))))))).}..}}.)))))))))).)))).)}..}||,...,||||}..,(((.{(((....(({,|{{{{{...,)))...|||||}.|||}.,,,.,,{|||.{{|,,,,..))))))))))})),))).)))))..)))))))))))))).)}))))))...}))))))}.,|||,,.,)))).,)})},..})}}}}}|||,,,..,,.}}}}}}..{,||||,,|,|,|||....,}},,}}|,.||||||{..{{|||,,{{{...................{((((........))))}.,,,,,.{(((((((..{,.{{{{||..|||||,{.....}}}}})))))}}}.))))))||{({.{(,,,||,,||}.,{||.|}}}..)}))),.))}))))}}}})))}}.....)))))))).))))).......,.|,{|{{{{..,||,,.|,||}},|,.,((((((({((((((({{.((((..(((((........)))))..))))...,,,.,....(((((((((....,,..(((((((({...}))).))))),,...((((((((...))))))))......(((((((((((((((.((.......))))))))),.((((((.((((.{(,((({..,.,,(((((((....(((({{...((.(((((((.(((((((..........(((((((....)))))))))))))).....((((({....(((((((({(((({((({{,....{{{,..{,,,|}}..{(.((((({,(({,.........,..(((((({(((((((,{....{{{{{(((((.,((({(((({({,..,.{(((.({{............))).)))).|{((((((((.,,....)),))))))))}}|||}.,}}}|(((((((.((((.(((((((((((((.........((((((((((((((.((.(((,.,({....}}))))))))))))))))))))..))))))))))))).)))).....(({...}))..)))))))}..{|{||||...,|||.......{|{,||||||||}}||||,(((((..(((....)))))))).,(((((.((..(((((...(((...(((((((((((((.({(((((.,.((((((((....)))))))).,)))))..)).))))|((((((((((.,((({,,.,,....((((.,{,....(((....}}),|||{((((({...})))))}...................{(((((((.({{{{,,,.........,,.,{{{{|,,.,)))))),,|{{{{{....,,,,,,..}}}}),.,,)),))))}))).))))......,)))).,.))))))))))}.,)))))))).))).)))))..)).)))))((((((.(((....))).)))))).,,,..))))}}),))),),))))))).((((((.....)))))).,,..,,(((((((.....))))))}(((((((((...(((((((((((((.(((((((((({..{((((.,(((....,,.....((((((...)))))))))},)))))))))))))))))))))).)))))}((.(((...))).)){{,.....,,,))))))))))))))))(((((((((((((((....))))},....}))))))))).....((.(((((.(((((...((({.,.,,....,,..,.})))...))))).))))).))....}))}.)))))),)}...})}))),,,,,,,....{{(,..||,,.....,,..}}},(((((.......,)))}}.|||.|,,(|{({{,....}}))}}|,({.(((,.....}}}.}}...||||,,.}}},.))))))))))))))))))...,((((({....(((({......)))))..,)))))),...)))))))))...)).))))....))))))),..)))),)).,..)))).))))))....((((....))))...})))..))))(((((.((((((((((,,{{{....,,||...}}......,,,.)))))))))).))))))))))))))...,|.|,{{{{{.||||,{{{,.,,{|||{|||}},|||||{|.......,||{{{{{.....})))))),,........{(({{{..{{{{{...{((((((({..{{{{{{,{{{..(((((((....)))))))..)))),}||{{{...)).)}},.)))))))))...)))))}))))),}}}}}}}}})}}.}))}))|,.,..}}})))))}}((((((.........)))))))))..

Transcripts

ID Sequence Length GC content
GCCGGUGGAACCUAGAGCCCCGCGGAAGAGCAGAACGUUUGGGAGUGUG… 7684 nt 0.3837
Summary

The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the SMARCA5 as an mRNA marker for age estimation, demonstrating its expression decreases with age in dried blood stain samples [Dørum et al. DOI:10.1016/j.fsigen.2023.102976]. This marker was part of a lasso regression-selected gene list that achieved a mean absolute error of 4.46 years for age prediction in the primary dataset, establishing its utility in a forensic mRNA assay for predicting a stain donor's chronological age.