| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUGGCCGUGUGAGCGUGAGGAGCUGCCGCCACCGCCUGCUCCUCGUCG… | 16062 nt | 0.4308 |
This gene encodes a protein involved in nonsense-mediated mRNA decay (NMD) as part of the mRNA surveillance complex. The protein has kinase activity and is thought to function in NMD by phosphorylating the regulator of nonsense transcripts 1 protein. Alternatively spliced transcript variants have been described, but their full-length nature has yet to be determined. [provided by RefSeq, Mar 2013]
A study in humans demonstrated that the SMG1 mRNA was down-regulated by 26% in pericontusional brain tissue from a patient with traumatic brain injury (patient T3) compared to control tissue, as identified through cDNA microarray analysis [Michael et al. DOI:10.1016/j.jocn.2004.11.003].