Basic Information

Symbol
BAK1
RNA class
mRNA
Alias
BCL2 Antagonist/Killer 1 BCL2L7 BAK CDN1 Bcl-2 Homologous Antagonist/Killer Apoptosis Regulator BAK Bcl-2-Like Protein 7 Bcl2-L-7 Pro-Apoptotic Protein BAK BCL2-Antagonist/Killer 1 BCL2-Like 7 Protein BAK-LIKE
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_001188.4
Sequence length
2170.0 nt
GC content
0.5862

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-939.00 kcal/mol
Thermodynamic ensemble
Free energy: -978.58 kcal/mol
Frequency: 0.0000
Diversity: 541.12
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((((.......)))).(((((.(((((..(((((((((((((...))))))).........(((((((((.((..((((((..(....)..))))))..))..))))....)))))...(((((((((..(....)..)))))))))......))))))...)))))(((.(((.((.((....))..)))))..))).(((((((((.((((((((((.((((.(((....(((..((((((((((((((..........(((((.(((.(.((((......((((.(((((((.(((..((((.((((...(((....))))))).))))))).))))))(((((((...)))))))).)))))))).).))).)))))......((((((((.(((((..((.((.((.....))...)).))..))))).)))))))).))))))).....(((((((((((....(((((((......))(((((((((.((((.((((...((.(((((....((((.((.(.((........)).).))))))....)))))))...))))..))).((..((((((((.((.(((((....(((((..((.(((.((((.(((..(((((((((.(((((.((.((((.((((..(.((((((((((((((.......(((((..(((....))).))))).......)))))).)))))))).)(((((((...)))))))((.((((.......(((((.((((.((.((((((((((.......))))))..))))))))))..))))))))).)).((((.......))))..)))).)))).))))))).)))))))))))).)))).))).))..)))))...))))).))..((((...)))).((((..(((.((((((((...)))))))))))..))))..(((((((((..((.....((.((((.......)))).))....))..)))))))))...........(((((...((....))...))))).((((......))))(((((((....))))))).....))))))))..))..........).)))))))))...((((((.......)))))))))))..)))))))))))........((((.((((((((((((((((((((.....)))).)))))))))........(((((((((((..(((((((..((.(((((((....)).))))).))..))))))).((((((.((((.....))))))))))((((((((((......((((.((((......)))).))))))))))).))).((((...((.((.(((((((......)))))))..)).))..))))........(((((((((.......))))))))).))).)))))))).....)))))))))))(((((((....((.((((.((((...((((.(((...((((((((((.((((((((((((((((..(((((.(((((....)))))))).))...)))))..........)))))).))))))))))))))).)))))))((.(((.(((((((....)).))))))))))....)))).)))))).)))))))...(((((((((((.....((((((..((.(((.((((((((...(((..(((((...)))))((((((((((((....(((...)))....))))))).)))))((((((..((((....((((........))))..))))))))))...........)))....))))))))..))).))..))))))........))))).)))))).....((((.((.((....)))).))))))))))))))...)))...)))).))))........)))))).))))))))).....(((((.(..(((((.(.(((((((((((.(((.(((((((((((....(((...)))..)))))))))))....((((((........)))))).(((...)))..)))))))..))))))).))))))..)))))).(((((((((((((((((.(((..((((...))))..)))..))))).))))....)))))))).................))))).
Thermodynamic Ensemble Prediction
..((((,..,,..,,,,.,((((.(((((.{(((((((((((((...))))))).........{(({(((((.((..((((((.,{....}.}))))))..))..))))}.,.,}|||...(((((((((..{....)..)))))))))...,,,)))))),).)))))))))(((((.(((.((((,{(((((({(((((,,{{{...{{(((((,(,,{.,,||,|,|}}|||}|...}},}))))((((,((({{...(,((((({(,{{{.(({{......||,}}}}||((..||}}},((({((((.{{((.{{{{(((|||{,|||{|||((((((((.,...,.}})).)))))}})},,.||{.{|||{|{|||{...,,,|,{{{.,{,,....,,,((((((((((.(..(((((((({..((((((....))))))(((,{((({.....,((((((...((((((.......((((..((((.((((({((((,,.,({(((((.,,.{{{{,((.{.{{........)).,.},}}}|....}}}}}}}.,.||||(((((((...)))))))....((((.....))))..{{{{,...,},((((,,.((((((,.........,.}.)))))),,..))))(((((((((((((.......(((((.,(({..,,)}}.))))).....,.)))))},)))))))...(((((({...})))))),|{{{{{|...}),))))}},.,,.,)}})),,,.)))).}))))).)))).}))).)))))))))))))))))))).((((.......))))...})}),..)))))..).)))))))))).|||||||,((|{(,,,{|||,,{{,{,(((((..((((...))))..)))))})}}|||||{||.,.}}}}}))))})},|{,,{{|},},,,}})})))}...}}}|,}},....))))))}))}}}})((((,(((((...)))))}}}}.{{{{{...{(,...))...)})))}))}}.)))}.))))))))||},,)}))))))}.))))),))))...((((((........,...))))))..,((((((.......)))))))))))))))))).).)).)))))...((((.((((((((((((((((((((.....)))).)))))))))........(((((((((((..(((((((..((.(((((((....})}})))).))..))))))).(((((((((((.....))))))))))((((((((((.,...,((((.((((......)))).))))))))))),})).((((,,.{{{({.(((((((......)))))))..}),,)}.)))).......,(((((((((.{.....))))))))),))).))))))))...,.)))))))))))(((((((....((.((((.((((...((({,(((...((((((((((.((((((((((({((((,,(((((.(((((....)))))))).)}...}})))....,,,...)))))).))))))))))))))).))))))).({(((.(((({{(....,,})))))))}})}...)))).)))))).)))))))..,({{{((((((({,..,,{{{,,....}||,.{{,(((((({{(((..(((((...)))))(((({.((((((((..(((((((((((({((((({{.(((((....))))).,((((.((((........))))..))))((((((.......))))))....,((((({.((((.,,,{{({{,{((((((.(((((..,...,.....,....))))).)))}}})||,}||}||||,,})}}|{|({(.((((((.,....,,...)))))).}}}.|.(((((((((.{,..........,}...))))))))),,)))).})))))))))))}...)))}}.))})))))..))))))))..((((((........))))))})))},)))),.)))))),.)))))))))},},.},,},.....(((((((((((((((((.(((..((((...))))..))).,)))}}.)))}}},.)))))))).......,,},,.......,,,.

Transcripts

ID Sequence Length GC content
ACAGAGCAACUUCCUCUAGAGGGAGCUGAUUGGAGCCGGGUGCCGCUGG… 2170 nt 0.5862
Summary

The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form oligomers or heterodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein localizes to mitochondria, and functions to induce apoptosis. It interacts with and accelerates the opening of the mitochondrial voltage-dependent anion channel, which leads to a loss in membrane potential and the release of cytochrome c. This protein also interacts with the tumor suppressor P53 after exposure to cell stress. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human cadaver liver tissues demonstrated that the BAK1 was down-regulated (-1356.767 fold) in decaying samples compared to a control [Javan et al. DOI:10.1007/S12024-015-9704-6]. In human prostate tissues, the BAK1 was significantly upregulated at longer postmortem intervals (96 and 120 hours) compared to a 24-hour control, indicating its utility for time-of-death estimation [Tolbert et al. DOI:10.1016/j.gene.2018.06.090]. A study in mice and human hematopoietic cells demonstrated that the proapoptotic factor Bak was upregulated in mouse bone marrow and spleen cells following γ-irradiation [Li et al. DOI:10.1007/s10495-016-1238-1].