| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGAGCAACUUCCUCUAGAGGGAGCUGAUUGGAGCCGGGUGCCGCUGG… | 2170 nt | 0.5862 |
The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form oligomers or heterodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein localizes to mitochondria, and functions to induce apoptosis. It interacts with and accelerates the opening of the mitochondrial voltage-dependent anion channel, which leads to a loss in membrane potential and the release of cytochrome c. This protein also interacts with the tumor suppressor P53 after exposure to cell stress. [provided by RefSeq, Jul 2008]
A study in human cadaver liver tissues demonstrated that the BAK1 was down-regulated (-1356.767 fold) in decaying samples compared to a control [Javan et al. DOI:10.1007/S12024-015-9704-6]. In human prostate tissues, the BAK1 was significantly upregulated at longer postmortem intervals (96 and 120 hours) compared to a 24-hour control, indicating its utility for time-of-death estimation [Tolbert et al. DOI:10.1016/j.gene.2018.06.090]. A study in mice and human hematopoietic cells demonstrated that the proapoptotic factor Bak was upregulated in mouse bone marrow and spleen cells following γ-irradiation [Li et al. DOI:10.1007/s10495-016-1238-1].