Basic Information

Symbol
SMN1
RNA class
mRNA
Alias
Survival Of Motor Neuron 1, Telomeric SMNT TDRD16A Gemin-1 BCD541 GEMIN1 SMA1 SMA2 SMA3 Survival Motor Neuron Protein Tudor Domain Containing 16A Component Of Gems 1 SMA@ SMA SMN Spinal Muscular Atrophy (Werdnig-Hoffmann Disease, Kugelberg-Welander Disease) Survival Motor Neuron 1 Protein T-BCD541 SMA4 SMNC
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_000344.4
Sequence length
1482.0 nt
GC content
0.4076

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-388.97 kcal/mol
Thermodynamic ensemble
Free energy: -419.63 kcal/mol
Frequency: 0.0000
Diversity: 387.04
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((....)))..))....(((((((((((((((((..(((((((.(.(((.(((((((((.(.(....).).))))))))).))).)..((((((.(((.((.(((((((...))))))).))...((..........))..........))).)))))).......(((((..........(((((.((((((((((((((.((.(......................(((...((((...............................)))).))).......((((((..(((((((...((((((((((((....)).))))........)))))).))))))).)))))).((((.((.(((((..(((......(((((((((((((..(((.((((..(((((((((..(((.((.....)))))..)))).)))))...)))))))....)))).))))))))).........)))...))))).))..))))).))))))))).)))))))..((.(((((.((((((...))))))........(((...(((..(((........)))..)))....))).))))).)).))))).....)))))..((((((.((...(((((.((....)).))))).....))..)))))).)))))))..)))))....((((((.....(((((((((.((((((((.(((.....(((....)))............((((((((...(((((......(((..((.......))..)))......)))))((((((.....((((((...)))))).......))))))((.((((((((((.(((.......(((((...((((((.....(((((((((((................(((((........))))).......................((((.....)))).)))))))).)))(((((........(((..(((..(((((((..(((((...)))))..).))))))..))).))).......)))))))))))))))).))).)))))))))).)).........(((((....))))).....((......))....((((((.....))).))))))))))).))).)))))))).)))))))))((((((((((((((((((.......))))))))).((((((........))))))(((..(((((((((((((((........))))))))))))))).)))..))))).))))((((((.(((((((.......))))))).))))))......((((((((....((((....)))).....)))))))).(((((((...))))))).........)))))).....))))))))))))..(((((((...((((((.((......)).))).)))....)))))))..((((((......))))))
Thermodynamic Ensemble Prediction
(((((....)),.,))....((((((((((((((,((..(((((((.(((({.(((((((((.(.(....).).))))))))),))(((...,|}|{((({,,...,|}||..,{(((((.((({......(((((....,{,,.,,...,,|||.{((((((((({...(({.((((...{{{(({{{,{{{{(((,...,{{,(({{...||......,,,,.......,.....{{{{,............,,,.....,.,,....{{.|||||||{......{{{{||..|||||{|},,|||||||{{{||.,,,}|,|}}},,,.|||.||,}},.)))}))}.))}}}},|{{..,{,.,,,,..|,|,,....(((((((((((((,.(((.((({..(((((((((..(((.((.....)))))..)))).)))))...}))))))....}))),,)))))))).........}),.)))).})).)))))}}}))))}}||||,.},.,))..,{|,.,,},((((((...)))))).....})))).....}))}..))))))),,))),,{{((,.............,.,,.......),}))},.((((((.((...(((((.((....)).))))).....)}..)))))).)),))))}}))))).||.((((((,,...(((((((((.((((((((.((({{,..,((...,||}...,,.......((((((((.,,(((((...{{.(((..((.......))..))),,,...))))){(((((.,,..((((((...))))))....|}.))))))((.((((((((((.(((.......{{({{...{{((({.,{,{(((((,,{((({{,...}}}}}},...(((((........)))))..........{{{{{........{,((,,...}}))|}}|||||}..}}{{{{{.....,,.|||..(((..(((((((..(((((...)))))..)}}}))))..))).)))}}..,}}))},)))))))))))).})).)))))))))).)).........(((({....})))),|,..{{......)}....{{{(((.....))).})))))))))),))).)))))))).)))))))))(((((((((({{{{(({{.,,,.,.||||}}}}|.{{((((........}))))}(((..(((((((((((({((.,....,.))})))))))))))).))).})))))}}}))((((((.(((((((,....,,))))))).))))))......((((((((.{{,((((....}))).,}}.)))))))).(((((({...))))))).........}))))).....))))))))))))..,{{{{{,...,,,,{,.{{......}}.}}}.))).,,.}}}}}}}..{{{,,,....,,)))},.

Transcripts

ID Sequence Length GC content
GCACCCGCGGGUUUGCUAUGGCGAUGAGCAGCGGCGGCAGUGGUGGCGG… 1482 nt 0.4076
CCACAAAUGUGGGAGGGCGAUAACCACUCGUAGAAAGCGUGAGAAGUUA… 1571 nt 0.4297
CCACAAAUGUGGGAGGGCGAUAACCACUCGUAGAAAGCGUGAGAAGUUA… 1545 nt 0.4136
Summary

This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. The telomeric and centromeric copies of this gene are nearly identical and encode the same protein. However, mutations in this gene, the telomeric copy, are associated with spinal muscular atrophy; mutations in the centromeric copy do not lead to disease. The centromeric copy may be a modifier of disease caused by mutation in the telomeric copy. The critical sequence difference between the two genes is a single nucleotide in exon 7, which is thought to be an exon splice enhancer. Note that the nine exons of both the telomeric and centromeric copies are designated historically as exon 1, 2a, 2b, and 3-8. It is thought that gene conversion events may involve the two genes, leading to varying copy numbers of each gene. The protein encoded by this gene localizes to both the cytoplasm and the nucleus. Within the nucleus, the protein localizes to subnuclear bodies called gems which are found near coiled bodies containing high concentrations of small ribonucleoproteins (snRNPs). This protein forms heteromeric complexes with proteins such as SIP1 and GEMIN4, and also interacts with several proteins known to be involved in the biogenesis of snRNPs, such as hnRNP U protein and the small nucleolar RNA binding protein. Multiple transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2014]

Forensic Context

A study in humans demonstrated that the SMN1 is a gene and protein marker highly expressed in the smooth muscle cell cluster of the corpus cavernosum, specifically identifying smooth muscle cells (SMCs) and distinguishing cavernosal trabecular SMCs from vascular SMCs when used alongside other markers like DES [Zhao et al. DOI:10.1038/s41467-022-31950-9].