| ID | Sequence | Length | GC content |
|---|---|---|---|
| GUUCCUCCCUUCCCCCUCGCCGCCGACCGAGUUCUUCCUUUUCAGACCG… | 4310 nt | 0.3684 |
This gene is a paralog of SMN1 gene, which encodes the survival motor neuron protein, mutations in which are cause of autosomal recessive proximal spinal muscular atrophy. The protein encoded by this gene is a nuclear protein that has been identified as a constituent of the spliceosome complex. This gene is differentially expressed, with abundant levels in skeletal muscle, and may share similar cellular function as the SMN1 gene. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the SMNDC1 gene was differentially expressed in blood leukocytes at 2 hours post-injury, showing upregulation in burn and trauma/hemorrhage models but downregulation following LPS infusion [Brownstein et al. DOI:10.1152/physiolgenomics.00213.2005].