| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCCAGAGAGCCCAGCGAGCUAGAGCAACAAAGGAGCCGGGUCGCCGG… | 3977 nt | 0.6218 |
The protein encoded by this gene is a G protein-coupled receptor that interacts with the patched protein, a receptor for hedgehog proteins. The encoded protein tranduces signals to other proteins after activation by a hedgehog protein/patched protein complex. [provided by RefSeq, Jul 2010] CIViC Summary for SMO Gene
A study in mice and human RWPE-1 cells demonstrated that cadmium exposure induced prostatic fibrosis, epithelial-mesenchymal transition, and primary ciliogenesis, which was associated with increased expression of the SMO as a marker of the activated SHH signaling pathway [Huang et al. DOI:10.1002/Jat.4436].