| ID | Sequence | Length | GC content |
|---|---|---|---|
| CCUCAACUUUGCGCCUGUUGCUGGGCCGCCGGCGCGCGGGCGGCCGCGA… | 1684 nt | 0.6110 |
This gene encodes a protein which was initially identified as a sphingomyelinase based on sequence similarity between bacterial sphingomyelinases and a yeast protein. Subsequent studies showed that its biological function is less likely to be as a sphingomyelinase and instead as a lysophospholipase. [provided by RefSeq, Oct 2009]
A study in human postmortem brain tissue demonstrated that the SMPD2 was up-regulated in the frontal cortex of alcoholic cases compared to controls, as identified through cDNA microarray profiling and validated by Bayesian statistical analysis and hierarchical clustering [Liu et al. DOI:10.1111/J.1471-4159.2004.02570.X].