| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAAGGAACCGGAAACGGGAUGGGGAGCUGGACCAGCAGAUUAUGAGCUU… | 2684 nt | 0.5101 |
This gene encodes a protein that participates in base excision repair by removing uracil from single- and double-stranded DNA. Many alternatively spliced transcript variants exist for this gene; the full-length nature is known for some but not all of the variants. [provided by RefSeq, Aug 2011]
A topographic transcriptomic analysis in mice identified SMUG1 as one of five seed transcripts with highly specific enhanced expression in the nucleus accumbens shell (NAcSh) [Crofton et al. DOI:10.1016/J.Neuropharm.2020.108398].