| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGACAAGAGGGCGGGUGGAGGAGGAAGCGGCCGAGCCCAGAGUUCUGCU… | 6240 nt | 0.4175 |
Enables SMAD binding activity; identical protein binding activity; and ubiquitin protein ligase activity. Involved in negative regulation of transforming growth factor beta receptor signaling pathway; positive regulation of trophoblast cell migration; and ubiquitin-dependent protein catabolic process. Located in nuclear speck. Part of ubiquitin ligase complex. [provided by Alliance of Genome Resources, Jul 2025]
A study in mice demonstrated that chronic methamphetamine administration significantly dysregulated the SMURF2 in microglia, which is a component of the ubiquitin-mediated proteolysis pathway [Oladapo et al. DOI:10.3390/Ijms26020649].