| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUGCGCCGCGGCACGGCCUAGCGAGUGGUUCUUCUGCGCUACUGCUGC… | 1705 nt | 0.5842 |
The Drosophila embryonic protein snail is a zinc finger transcriptional repressor which downregulates the expression of ectodermal genes within the mesoderm. The nuclear protein encoded by this gene is structurally similar to the Drosophila snail protein, and is also thought to be critical for mesoderm formation in the developing embryo. At least two variants of a similar processed pseudogene have been found on chromosome 2. [provided by RefSeq, Jul 2008]
A study in human menstrual blood-derived mesenchymal stem cells (MenSCs) from women with endometriosis demonstrated that the SNAI1 gene was overexpressed and involved in the upregulated epithelial-mesenchymal transition pathway [Penariol et al. DOI:10.3390/ijms231911515].