| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUUCGUAAAGGAGCCGGGUGACUUCAGAGGCGCCGGCCCGUCCGUCUG… | 2180 nt | 0.4124 |
This gene encodes a member of the Snail family of C2H2-type zinc finger transcription factors. The encoded protein acts as a transcriptional repressor that binds to E-box motifs and is also likely to repress E-cadherin transcription in breast carcinoma. This protein is involved in epithelial-mesenchymal transitions and has antiapoptotic activity. Mutations in this gene may be associated with sporatic cases of neural tube defects. [provided by RefSeq, Jul 2008]
No relevant information is available at the moment.