| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCUUUGAUGAGGGCAGAGCUCACGUUGCAUUGAAGACGAAACCUCGGG… | 2289 nt | 0.4452 | |
| AUCUUUGAUGAGGGCAGAGCUCACGUUGCAUUGAAGACGAAACCUCGGG… | 2053 nt | 0.4267 | |
| AUCUUUGAUGAGGGCAGAGCUCACGUUGCAUUGAAGACGAAACCUCGGG… | 2053 nt | 0.4291 |
Synaptic vesicle membrane docking and fusion is mediated by SNAREs (soluble N-ethylmaleimide-sensitive factor attachment protein receptors) located on the vesicle membrane (v-SNAREs) and the target membrane (t-SNAREs). The assembled v-SNARE/t-SNARE complex consists of a bundle of four helices, one of which is supplied by v-SNARE and the other three by t-SNARE. For t-SNAREs on the plasma membrane, the protein syntaxin supplies one helix and the protein encoded by this gene contributes the other two. Therefore, this gene product is a presynaptic plasma membrane protein involved in the regulation of neurotransmitter release. Two alternative transcript variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
A study in humans developed an endpoint RT-PCR multiplex assay for organ tissue identification, where the SNAP25 was validated as a specific mRNA marker for brain tissue identification, showing expression in brain and spinal cord [Lindenbergh et al. DOI:10.1007/s00414-013-0895-7]. Another study in humans developed a massively parallel sequencing mRNA profiling assay, confirming the SNAP25 as a highly expressed mRNA marker for brain tissue identification with an average read count of 167,707 [Hanson and Ballantyne DOI:10.3390/genes8110319]. A study in Sprague Dawley rats demonstrated that transgenerational effects of adolescent morphine exposure include sex-specific dysregulation of synaptic plasticity genes in the nucleus accumbens, where the SNAP25 was upregulated in male grandoffspring (F2) and downregulated in female grandoffspring compared to saline controls [Fair M. Vassoler et al. DOI:10.1016/j.neuropharm.2016.10.006].